malonge
Ragtag scaffold inserted a uracil.
Very strange error. I ran ragtag scaffold using a published genome (GWHETLT00000000.1) and my own assembly. Neither assembly has any "U" bases within them. Somehow, ragtag scaffold generated a Uracil in the resulting output. Only a single U was inserted into the middle of a 2.1 Gb scaffolded ragtag.scaffold.fa file. I am at a loss to explain how this happened and now I don't trust the output.
(base) minknow@pop-os:~/Desktop/alligator/ragtag_output$ cat ragtag.scaffold.80.fasta | grep U CGCTGUAGCACCCTACAGCTTCTAGCCTGAGCCACTGCAGGCATGTGGCTGCATTTTCAGGATCAAAAGTGAATGTCTGT
There's also an @ in it?!
(base) minknow@pop-os:~/Desktop/alligator/ragtag_output$ sed -n '15809930p;15809931q' ragtag.scaffold.fix.80.fasta TGTTAGGGGAGGGCCAGAGGTCCAGAGATACAAGTAAGTGTTTAGGACAAAAGGAGAAAACAAAACATTTC@GATTTCAA