Edgardo M. Ortiz
Edgardo M. Ortiz
Dear Ryan, I wonder if you have a direct comparison between the flip_flop model included in guppy 2.2.3 and the new FAST and HAC models in guppy 3.2.2 We would...
Hello Kristoffer, I ran `NGSpeciesID` with the following command: ``` for file in *.fastq; do NGSpeciesID --t 4 --ont --fastq $file \ --consensus --medaka \ --abundance_ratio 0.005 \ --rc_identity_threshold 0.85...
Sometimes `fastp` detects what could be real genomic repetitive sequence as adaptor, for example: ``` Detected read1 adapter: | AACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACC ``` Has anyone else seen this behaviour? My command was:...
Hello, I would like to insert plots from Plotly, I have been trying the solutions listed here: https://mertbakir.gitlab.io/hugo/plotly-with-hugo/ and following the example from here: https://github.com/kc-tal/hugo-plotly-example But it doesn't work with...
I understand the main goal of MEGAHIT is metagenome assembly but I found it very useful for regular assemblies as well. I tried SOAPdenovo-fusion with results that look promising, but...
Hello, I installed both gcc 5 and 6 with `brew` and tried to compile with: `make CC=/usr/local/Cellar/gcc\@6/6.5.0_2/bin/g++-6` or `make CC=/usr/local/Cellar/gcc\@5/5.5.0_3/bin/g++-5`, and get the same error message for both: ``` /usr/local/Cellar/gcc@5/5.5.0_3/bin/g++-5...
**Is your feature request related to a problem? Please describe.** No problem, just an improvement **Describe the solution you'd like** Write the median depth to the description of each FASTA...
I wonder if [these secondary structure models](https://cme.h-its.org/exelixis/web/software/raxml/hands_on.html) have been implemented also in IQ-TREE or if there is a way to use them by providing a configuration file or something similar....
Thanks for developing GetOrganelle, it seems very complete and thorough. I am trying it for species of Ericaceae, hopefully it will handle the small repeats better than other software I...
Hi, I found the tool useful and easy to use, therefore I wanted to include it in a pipeline that I would like to make available in Mac and Linux....