Daniel Guariz Pinheiro

icon indicating a website link http://about.me/dgpinheiro icon indicating an email [email protected]

icon company São Paulo State University icon location Faculty of Agricultural and Veterinary Sciences

Results 2 issues of Daniel Guariz Pinheiro

Weird behavior

6 comment

Hi, We are using scythe to trim 3' adapter but we found a very weird behavior using this sequence (in.fq): @014_1000001169_x1 AAAAAAGATGCCAGTTGAAGAACTGATGGAATTCTCGGGTGCCAAAGAACTAAAG +014_1000001169_x1 BBBB>>1111B1B1BBBBF1BF1BB1B11BBBBAD3A00A0BBDB00BB0D1AB1 and adapter fasta file (adapt.fa): >...

Atropos was stuck while waiting for a subprocess or worker thread to finish

The problem occurs with large files using the multithreading option (-T/--threads): atropos never finish the main process. Sometimes the error message "ERROR: Waiting on Result process to terminate for 60.1...