Caleb Lareau

Hi kallisto team, I'm trying to quantify gRNAs for a scRNA/Perturb-seq experiment. The barcode/umi/gRNA are on a single-end read. I've created an index using `kite` and then attempted to use...

UMI in Sam Tag

2

I would like to request support for processing UMI data that is contained in a sam tag (e.g. the UB tag in 10x data-- https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/output/bam). This is supported in Picard....

Single-end read with UMI

3

Does `gencore` work with data like this, which is common in scRNA-seq? My read names look like this: `A00439:244:HFHN5DRXX:1:2139:21052:22357_CGAGAGGTACCTGTGAATTG` where the first part of the string is what the sequencer...

Behavior relative to picard?

1

Hi, I separately tried running `gencore` on a paired-end sequencing run ``` gencore -i mix_2lines_PE.bam -o gencore_out.bam -r $fasta -s 1 ``` The input `.bam` file is `738MB`. The output...

Issue with build

6

I tried running the installation from the README, and everything went smoothly until the last step(`./gradlew clean jar`), which gives: ``` FAILURE: Build failed with an exception. * Where: Build...

Inflated alignment stats

3

Can get over 100% mapping from current bowtie2 parse