Julien A Nguinkal
Julien A Nguinkal
Hi @rvaser Thanks for replying. >git status ``` On branch master Your branch is up to date with 'origin/master'. Changes not staged for commit: (use "git add ..." to update...
```> head -n 1016410 zander_pooled.subreads.renamed.fasta | tail -n 2``` just output this: AGAGCTCTGTCCACGTCAATATCGCTCCTAATTTACATTTCACCTTATTTAAACGCTTTT GGTGTTTTGTGTAGGTTATTCCCTCTTTCAGTAATGTAAGCATTAACTGCGATGCCGCTA Why not -n 508204 instead of -n 1016410? Best, Julien ``` > git log in ra/vendor/rala```...
Okay, I understand the issue. But how can I fix it? unfortunately I cannot send some sample data because the files are about ~950GB for illumina PE data and ~120GB...
Ok, here is the command I ran ``` $: ./ra -t 100 -x pb /path/to/pacbioData/SMRT_Sequel-pooled/zander_pooled.subreads.renamed.fasta /path/to/pe-reads/pooled/in/one/singleFile/HiSeqX/pe.renamed.fastq```
Yes, I renamed my reads with Ids like: >1 READ1 > 2 READ2 ...
Sorry. No reads were renamed, just the headers in NGS reads file
Okay, I have just copied the whole log file, since I do not know in which part you are interested to. ```commit 758cc8132660e2fe8849d8651f3a60d02a9a923e Author: rvaser Date: Fri Nov 16 23:29:36...
ok, sorry. It will take a while to run. I will post here tomorrow.
Hi @rvaser , can I send you the whole log file by email? The same error has occurred. ``` [M::main] CMD: /Zander_Project/pipelines/assembly/ra/vendor/minimap2/minimap2 -t 130 -x ava-pb /Zander-Project_2017_2020/RawData/Zander_SMRT_Sequel/SMRT_Sequel-Pooled/zander_pooled.subreads.renamed.fasta /Zander-Project_2017_2020/RawData/Zander_SMRT_Sequel/SMRT_Sequel-Pooled/zander_pooled.subreads.renamed.fasta [M::main] Real...
@rvaser I have just sent the read of interest via email.