aushev

Misleading error message about multi-sample when no read groups are present

12

HaplotypeCaller checks for `samplesList.numberOfSamples() != 1`. The idea was probably about detecting cases with `> 1`, but when no `@RG` present in the BAM file (i.e. `== 0`), it throws...

Example query here: [overpass-turbo.eu/s/1DQd](https://overpass-turbo.eu/s/1DQd) ``` [out:csv(::id,::type,::lat,::lon, name; true; ",")]; way[name ~ ' Trial'](48.71,-120.9,55.16,-110.4); out; ``` When object `name` contains " Error" string (like this [way 353969638](https://www.openstreetmap.org/way/353969638)), it raises Query Error:...

how cSplit() treats multiple splitCols when they contain different number of fields

4

Here is example table: ``` r dt1

record is lost if splitCols contains empty value

8

Example of code to reproduce: ``` R dt1

error when opening valid .fastq.bz2 (Ran out of data in the middle of a fastq entry. Your file is probably truncated)

6

Trying to run FastQC for my bz2-compressed file `fastqc 08asp.fastq.bz2` - I get the following error: > Started analysis of 08asp.fastq.bz2 > Failed to process file 08asp.fastq.bz2 > uk.ac.babraham.FastQC.Sequence.SequenceFormatException: Ran...

Duplicated sequences in contaminant_list.txt

1

I think it's a bit confusing that many sequences in the list are duplicated, for example `AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA` is listed 5 times, with different names: - Illumina DpnII expression PCR Primer...

I have an impression that sequences of the Illumina TruSeq adaptors starting from Index 13 are wrong. I checked in couple sources, including [Illumina website](https://support.illumina.com/downloads/illumina-adapter-sequences-document-1000000002694.html), and starting from Index 13...