terminate called after throwing an instance of 'std::out_of_range'

[signor-molevol]

I'm having an issue with bedtools coverage throwing this error:

terminate called after throwing an instance of 'std::out_of_range' what(): basic_string::substr Aborted

The command is as follows: bedtools coverage -counts -a in.gtf -b in.bam > out.counts

Its happening with multiple data sources, not limited to a specific bam file. The input files were mapped with bowtie, and can be viewed without a problem in IGV. I can find a little bit of documentation for this error for a different bedtools command, but nothing that addresses this problem.

[arq5x]

What version of bedtools? Could you see if the problem exists with the current version (2.28.0)? Could you share a minimal bam file and gtf that create this problem? Without test data, it will be difficult to track down.

[shaniAmare]

Hi @signor-molevol and @arq5x,

Wondering whether you were able to sort this issue out. Does the new version of bedtools had this fixed? I'm facing the same issue processing a cellranger output bam file with bedtools/2.26.0.

The error specifically is:

terminate called after throwing an instance of 'std::out_of_range'
  what():  basic_string::substr
Aborted (core dumped)

My sorted x.bam file` looks like this:

NB500916:538:H53VMBGXB:2:12112:24730:13694      1107    1       9997    0       8S64M   =       10052   -9      TAGTCAAACCGATACCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC        <//////E/////E/E<EEEEEEAEE/AEEEE//AEEE/EEAEEEEEEEEAEEAEEEEEEAEEEEE6AAAAA        NM:i:1  MD:Z:6A57       MC:Z:59M13S     AS:i:59 XS:i:59 CR:Z:TAGCCGGCACGTACAT   CY:Z:EEEEEEAEEEEA/AAA   CB:Z:TAGCCGGCACGTACAT-1 BC:Z:CAGTCTGG   QT:Z:AAAAAEEE   GP:i:10060      MP:i:10051      MQ:i:0  RG:Z:cellmix_ATACseq:MissingLibrary:1:H53VMBGXB:2
NB500916:538:H53VMBGXB:3:11401:25100:3089       99      1       9998    0       51M21S  =       10183   236     CCATAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCGTGGCACTTAGACTCATCGAC        AA/AAEAEEEEEEEEAEEEEAE/AAEEAEEEEEEEEAEEEA/EE<</E//<////E//////////A////A        NM:i:1  MD:Z:1G49       MC:Z:21S51M     AS:i:49 XS:i:49 CR:Z:ATGTAGACAAAGTAAG   CY:Z:/EEE//EEAEEA6AAA   CB:Z:ATGTCGACAAAGGAAG-1 BC:Z:TCACACTC   QT:Z:AAAAAEEE   GP:i:9997       MP:i:10233      MQ:i:0  RG:Z:cellmix_ATACseq:MissingLibrary:1:H53VMBGXB:3
NB500916:538:H53VMBGXB:4:13505:6021:18953       163     1       9998    0       49M23S  =       10005   79      CCATAACCCTAACCCTAACCCTAACCCTAACCATAACCCTAACCCTAACAATAACACTAACACAAAAAAAAA        AA/AAEEEEAEEEEEAEEEEEEEAEAAEEAEE//EAEA<AE//A//</A///E/EE6/E/////<A/<//EE        NM:i:2  MD:Z:1G30C16    MC:Z:72M        AS:i:42 XS:i:43 CR:Z:CGCAGGTAGTGTAATG   CY:Z:EAAAEAE/EA/AA/A6   CB:Z:CGCAGGTAGTGTAATG-1 BC:Z:ATTGGGAA   QT:Z:AAAAAEEE   GP:i:9997       MP:i:10076      MQ:i:0  RG:Z:cellmix_ATACseq:MissingLibrary:1:H53VMBGXB:4
NB500916:538:H53VMBGXB:4:23608:22302:19204      147     1       9998    0       9S63M   =       10021   -40     ATACCTAATCGATAACCCTATCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC        <//////A/////////////E///A/A//////66//E//EE/EEAE//EEEEEEEEEEEEEEEEEAAAAA        NM:i:1  MD:Z:11A51      MC:Z:72M        AS:i:58 XS:i:55 CR:Z:CCAGAATAGGTTAGTA   CY:Z:EEEEEEAEAEEAAAAA   CB:Z:CCAGAATAGGTTAGTA-1 BC:Z:CTTTCGAC   QT:Z:AAAAAEAE   GP:i:10060      MP:i:10020      MQ:i:0  RG:Z:cellmix_ATACseq_Lib10:MissingLibrary:1:H53VMBGXB:4
NB500916:538:H53VMBGXB:4:11408:6721:18214       147     1       9998    0       40S32M  =       10010   -20     TTTATCCTAATTGTCTTTTTACTGATAACCCTATCCTTATCGATAACCCTAACCCTAACCCTAACCCTAACC        ///////E/////E///////////E////66///</E////////////E///AEE/E6EAEEEEEAA//6        NM:i:0  MD:Z:32 MC:Z:72M        AS:i:32 XS:i:30 CR:Z:TGAGTCAGTATCCTTT   CY:Z:EAEEEAEEAAEAAAAA   CB:Z:TGAGTCAGTATCCTTT-1 BC:Z:ATTGGGAA   QT:Z:A/AAAEEA   GP:i:10029      MP:i:10009      MQ:i:0  RG:Z:cellmix_ATACseq:MissingLibrary:1:H53VMBGXB:4

My custom sorted y.bed file looks like this:

1      135211  135302  .       .       +       new     exon    .       exon_id=exon:135212_135302;Parent=transcript:ENSG00000015171.19_135212_248990_1;rank=1
1      135454  135559  .       .       +       new     exon    .       exon_id=exon:135455_135559;Parent=transcript:ENSG00000015171.19_135455_211023_1;rank=1
1      135454  135559  .       .       +       new     exon    .       exon_id=exon:135455_135559;Parent=transcript:ENSG00000015171.19_135455_248608_1;rank=1
1      135522  135559  .       .       +       new     exon    .       exon_id=exon:135523_135559;Parent=transcript:ENSG00000015171.19_135523_210993_1;rank=1
1      248973  249088  .       .       +       new     exon    .       exon_id=exon:248974_249088;Parent=transcript:ENSG00000015171.19_248974_254634_1;rank=1
1      814945  815060  .       .       -       new     exon    .       exon_id=exon:814946_815060;Parent=transcript:ENSG00000107929.14_811213_815060_1;rank=3
1      829384  829496  .       .       -       new     exon    .       exon_id=exon:829385_829496;Parent=transcript:ENSG00000107929.14_811806_829496_1;rank=8
1      988433  988527  .       .       +       new     exon    .       exon_id=exon:988434_988527;Parent=transcript:ENSG00000107937.18_988434_1010517_1;rank=1
1      988433  988527  .       .       +       new     exon    .       exon_id=exon:988434_988527;Parent=transcript:ENSG00000107937.18_988434_1017691_1;rank=1
1      988433  988527  .       .       +       new     exon    .       exon_id=exon:988434_988527;Parent=transcript:ENSG00000107937.18_988434_1017691_3;rank=1

I used the following script to get the output bedtools coverage -hist -abam x.bam -b y.bed > coverage.tab

[da-i]

Also ran into this issue on version v2.26.0:

  what():  vector::_M_range_check: __n (which is 21840194) >= this->size() (which is 2779)
Aborted

Using version v2.29.0 fixed the issue.

[dachengai]

I use this script bamToBed -i test.sort.bam -cigar -bed12 > test.bed get same error ! on version 2.23.0