Using a compressed file during the "pregraph" process may lead to program exit

[shiinachaos]

Hi developers, I am trying to build an assembly with SOAPdenovo2, but i have noticed a issue. My input files are a pair of compressed fq.gz files. When I use version 2.40 (installed by conda), the program just goes into a loop of trying to reads sequences from my input files. It looks like this issue: https://github.com/aquaskyline/SOAPdenovo2/issues/15. I notice that you have fix this issue in new version, so I install the version 2.42. When I run again with the new version, the program exit and leave a warning information looks like:

readseqInLib return error! please make sure input file is correct fastq/fasta file 
invalid data left in buffer:
CCGGTAAGCGGGCAGGAGGGTGAGGGGGCAGGAGGGTGGGCGGGCAGGAGGGTG
+
GGGBGGGFGFGF@GGGGGGGGGGGGFGGGGGCFGGGGGGGGGGGGFGGDEFFGGGGGFGGGGGGGBGGGFFGGGEGGG<GCGGDGGGGGFGGGFFGGGGEFGDGGGGGGGFG:GEDFGGGGFGFAGBFDGGFFGGGGGGGGGGFGGGGFF

I checked the format of the input files. They are correct. And then, I decompressed the input files and run again. In other words, my input files are a pair of uncompressed fq files. This time, the program runs smoothly without any warning.

To confirm whether all compressed input files cause the program to exit, I use another pair of compressed fq.gz files as input file. But this time, the program also runs smoothly without any warning.

I'm not sure why this issue is occurring, and I hope you can fix it.