Håkon Tjeldnes

Reactive selectizeInput box fail to update correctly in Shiny 1.8.0, first value of previous allowed choices are kept

2

### System details Browser Version: Output of `sessionInfo()`: ``` R version 4.3.0 (2023-04-21) Platform: x86_64-pc-linux-gnu (64-bit) Running under: Ubuntu 22.04.3 LTS Matrix products: default BLAS: /usr/lib/x86_64-linux-gnu/blas/libblas.so.3.10.0 LAPACK: /usr/lib/x86_64-linux-gnu/lapack/liblapack.so.3.10.0 locale: [1]...

Comment is not hashed, easy fix (add hash): https://github.com/r-lib/remotes/blob/ac483e7d893ea8b7378d01f4456fc40a9a41936e/man/install_github.Rd#L118

Mitocondrial chromosome naming, seqlevelsStyle()

4

I thanks for a nice function, I use seqlevelsStyle a lot. One thing has always bothered me, is for the mitocondrial chromosome. Two objects with same naming convention as these:...

Allow input of already p-shifted reads (bigwig)

3

**Is your feature request related to a problem? Please describe.** This tool can not input already shifted data, makes it less useful for the community, since sometimes large bigwig files...

psite HDF5 file is saved in the wrong location

2

Correct me if I am wrong, but currently, the hdf5 file with psite information is saved in working dir and not in defined output-dir, this makes it fail if output-dir...

Added weights to coverage by transcript, I have not made this work for GAlignmentList, only GAlignment and GAlignmentPairs. So maybe we discuss what to do with that one ?

coverageByTranscript weights ?

8

For human data, using human NGS reads (1.4GB) as GRanges: ``` # Using reduced data that has a score column for duplicated reads, # every unique read is only once....

pmapFromTranscripts strange behaviour

12

There is some strange behavour on how it handles names in the transcripts: Sorry for bad test data, made this quickly: tx is a GRangesList of 100.000 transcripts: ranges is...

IGV gives coordiantes as this: "chr5:37614,351-37614537:+" Would be nice if the GRanges string constructor would accept "," in the string. Now this fails: ``` GRanges("chr5:37,614,351-37,614,537:+") #

If you give fastqc 2 adapters to search: adapter1: AATTAATTAATT (width = 12) adapter2: AAATTTGGGAAAAAATTTGGGAAA (width=24=max_adapter_size) Let us say all reads in the fastq file are 51nt long: Fastqc will...