Determine significant coverage and score value in the ipdSummary gff

[uceleste]

Hi All,

I would like to know what is the coverage and score value in the ipdSummary gff to consider a modified base as confident.

Example:

seqname	source	feature	start	end	score	strand	frame	coverage	context	IPDRatio	CognateBase
genome	kinModCall	modified_base	64078	64078	42	-	.	764	TTCGCAAGAAGACCTGAAGACCCTAGTGAAGTTTCTTCTTC	1.53	C
genome	kinModCall	modified_base	63115	63115	21	-	.	759	TATAGTGAAATGAGAGGGAGTTACGAGGAGCAATGTAATGC	1.41	T
genome	kinModCall	modified_base	63168	63168	28	-	.	759	AGCCATGCTTCGTTTGTGGAGGGGTGAAACATTTAGCTAAG	1.46	G
genome	kinModCall	modified_base	63203	63203	62	-	.	757	AGGAATCCACATGGTCACAAGGGCAGAGTCACAAGAGCCAT	1.74	G
genome	kinModCall	modified_base	61924	61924	73	-	.	756	TTCGGGAACATGATCTTGGAGGTAAATGTTTTCCACATTGC	1.87	G

Thanks

[rhallPB]

Score is dependent on coverage, and it isn't always possible to define a confidant cutoff. I would plot the data that you have (coverage vs score), the modified bases should form a distinct cluster. From the plot you should be able to define a function to distinguish modified from unmodified bases. Obviously this is much easier if you have some kind of control, known modified motif etc.