Weixiang Wang
Weixiang Wang
Hi Thomas! Recently I read related articles about HipSTR and I'm confused about region segmentation problem of HipSTR. As I know, lobSTR calculates entropy to segment STR regions and flanking...
Hi, Recently I have been processing some haploid vcf files from HipSTR output and I find I can't merge haploid data through mergeSTR, and the errors are as follows: TypeError:...
Hi, I use abPOA to produce multiple consensus sequence, three most frequency sequences are > 1 with a depth 25 CCCTCCCTTCCTTTCTTTCTCTCTTTCTCCCTCTCTTTCTCTTTCATTTTTCCTC > 2 with a depth 40 CCCTTCCTTCCTTTCTTTCTCTCTTTCTCCCTCTCTTTCTCTTTCATTTTTCCTC > 3...