Jingyao711
Jingyao711
**I was running code from quick start part, but I got this error;** --------------------------------------------------------------------------- AssertionError Traceback (most recent call last) Cell In[8], [line 3](vscode-notebook-cell:?execution_count=8&line=3) [1](vscode-notebook-cell:?execution_count=8&line=1) dna = "ACGTAGCATCGGATCTATCTATCGACACTTGGTTATCGATCTACGAGCATCTCGTTAGC" [2](vscode-notebook-cell:?execution_count=8&line=2) inputs...
This is my config file  I got the model to train with our data, but the result is a bit wired. The train loss is decreasing but the val...