installation error

[cccnrc]

when try to install hap.py through:

python install.py ~/hap.py-install --with-rtgtools

I got an errror with this step:

cd /home/enrico/hap.py-install && /home/enrico/app/benchmarking-tools/tools/hap.py/src/sh/run_tests.sh

2020-09-04 13:10:45,567 WARNING No reference file found at default locations. You can set the environment variable 'HGREF' or 'HG19' to point to a suitable Fasta file. 2020-09-04 13:10:45,568 WARNING No reference file found at default locations. You can set the environment variable 'HGREF' or 'HG19' to point to a suitable Fasta file. Running 86 test cases... Testing klib alignment. Score: 3 ref: 7-9 alt: 2-4 Cigar: 2S3M Testing klib indel alignment. Score: 22 ref: 0-32 alt: 0-37 Cigar: 17M5D16M Score: 22 ref: 0-37 alt: 0-32 Cigar: 17M5I16M Score: 27 ref: 0-49 alt: 0-51 Cigar: 22M5D2M3I23M Score: 4 ref: 0-26 alt: 0-28 Cigar: 11M5D2M3I11M Score: 7 ref: 0-18 alt: 0-24 Cigar: 15M6D4M Score: 7 ref: 0-18 alt: 0-24 Cigar: 9M6D10M Score: 20 ref: 0-24 alt: 0-24 Cigar: 25M Score: -55 ref: 0-149 alt: 0-68 Cigar: 53M6I9M66I6M9I1M Testing Ksw performance for read realignment.

size klib klibg 160 100 29864.6 402731 160 100 25938.9 435299 160 100 35002.3 395220 160 100 28450.7 392572 160 100 26399.2 394415 160 100 26564.2 416286 160 100 31125.3 395367 160 100 25008.8 377188 160 100 26915.6 372298 160 100 25306.4 375384 160 100 25589 398139 160 100 26978.6 393052 160 100 25978.5 376719 160 100 24971.4 374280 160 100 24948 372595 160 100 25171 391740 160 100 27323.5 401246 160 100 26977.4 372430 160 100 25317.3 376612 160 100 25467 374166 160 100 25060.7 375196 160 100 44745.3 417062 160 100 24946.6 374662 160 100 26272.6 375367 160 100 25096.6 374691 160 100 24702.7 373317 160 100 29538 411421 160 100 24942.4 377805 160 100 25223.1 373111 160 100 24973.8 376025 160 100 24988.2 377370 160 100 25086.5 424192

Testing Ksw performance for Haplotype comparison.

size klib klibg 128 27432.4 394713 192 47893.9 879216 256 72017.6 1.5735e+06 320 101614 2.42552e+06 384 132580 3.44832e+06 448 183979 4.66798e+06 512 229388 6.06243e+06

chrS:12-12 12-12:A . 0/1 0/1 chrS:13-13 13-13:C . 0/1 0/1 chrS:14-14 14-14:A 14-14:C 0/1 0/2 1/2 chrS:18-18 18-18:T 0/1 . 0/1 chrS:24-24 24-24:C 0/1 . 0/1 chrS:25-29 25-29: . 0/1 0/1 chrS:27-27 27-27:C 0/1 . 0/1 chrS:35-38 35-38: . 0/1 0/1 chrS:40-40 41-40:TCACAGCTAATCACTAATCA 0/1 . 0/1 chrS:44-44 44-44:C . 0/1 0/1 chrS:46-46 46-46:T . 0/1 0/1 chrS:47-47 47-47: . 0/1 0/1 /home/enrico/app/benchmarking-tools/tools/hap.py/src/c++/test/test_diploidreference.cpp(192): error in "diploidReferenceBasic": check expected.count(ss.str()) == (size_t)1 failed [0 != 1] /home/enrico/app/benchmarking-tools/tools/hap.py/src/c++/test/test_diploidreference.cpp(192): error in "diploidReferenceBasic": check expected.count(ss.str()) == (size_t)1 failed [0 != 1] Reading "/home/enrico/app/benchmarking-tools/tools/hap.py/src/data/chrQ.fa" Reading "/home/enrico/app/benchmarking-tools/tools/hap.py/src/data/chrQ.fa" Reading "/home/enrico/app/benchmarking-tools/tools/hap.py/src/data/chrQ.fa" Reading "/home/enrico/app/benchmarking-tools/tools/hap.py/src/data/test_formats.vcf.gz" Reading "/home/enrico/app/benchmarking-tools/tools/hap.py/src/data/test_formats.vcf.gz" ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ Reading "/home/enrico/app/benchmarking-tools/tools/hap.py/src/data/test.vcf.gz" [W::vcf_parse_format] FORMAT 'GT' is not defined in the header, assuming Type=String [W::vcf_parse_format] FORMAT 'GT' is not defined in the header, assuming Type=String Reading "/home/enrico/app/benchmarking-tools/tools/hap.py/src/data/test.vcf.gz" Reading "/home/enrico/app/benchmarking-tools/tools/hap.py/src/data/hapblocks.vcf.gz" Reading "/home/enrico/app/benchmarking-tools/tools/hap.py/src/data/test.vcf.gz" Reading "/home/enrico/app/benchmarking-tools/tools/hap.py/src/data/test.vcf.gz" Reading /home/enrico/app/benchmarking-tools/tools/hap.py/example/multimerge/hap_alleles_1.vcf.gz Reading /home/enrico/app/benchmarking-tools/tools/hap.py/example/multimerge/hap_alleles_2.vcf.gz [W::vcf_parse_format] FORMAT 'GT' is not defined in the header, assuming Type=String [W::vcf_parse_format] FORMAT 'GT' is not defined in the header, assuming Type=String

*** 2 failures detected in test suite "Master Test Suite" Boost Unit tests FAILED!

Do you have any idea?