Help with scoring custom sequence

[albustruong]

Hi Kishore,

Thanks a lot for your effort building this tool.

I've been trying to score a custom sequence using your provided script:

*from keras.models import load_model from pkg_resources import resource_filename from spliceai.utils import one_hot_encode import numpy as np

input_sequence = 'CGATCTGACGTGGGTGTCATCGCATTATCGATATTGCAT'

context = 10000 paths = ('models/spliceai{}.h5'.format(x) for x in range(1, 6)) models = [load_model(resource_filename('spliceai', x)) for x in paths] x = one_hot_encode('N'(context//2) + input_sequence + 'N'(context//2))[None, :] y = np.mean([models[m].predict(x) for m in range(5)], axis=0)

acceptor_prob = y[0, :, 1] donor_prob = y[0, :, 2]*

Unfortunately, I couldn't find any output in my working directory. I'm unsure whether it's because it didn't run successfully or because there were no scores to output so there's no output file. Can you help me with this?

Thanks a lot.

Albus.