FabianRoger

Hi Daijiang. Thank you for taking the time to walk us through! I'll chime in here as I am working together with @jebyrnes on this and have taken a deep-dive...

Hi, I am on a MacbookPro 13 "" M1 running MacOS BigSour. I have tried to install deML but it fails. I have cmake installed. The full error I get...

unfortunately that's not an option right now. Does this mean it wont work on my laptop? thanks for the fast answer!

of course. thanks again for the quick response

classify by primer (removing would be the next step although it could be done in one). It is quite common that we pool amplicons generated with different primer pairs onto...

in my case I use the following primer pairs: PRIMER 1 Fwrd: GGWTGAACWGTWTAYCCYCC Rev: TAAACTTCAGGGTGACCAAAAAATCA PRIMER 2 Fwrd: CGAGAAGACCCTATGGAGCTTA Rev: AATCGTTGAACAAACGAACC Note that the first forward primer does indeed contain...

sorry I just saw you suggestion, I had only seen your question about the barcode sequence. I will try it out later this week and come back to you. I...

I meant macOS 10.12. And I don't know how frequent the problem is, I just realized that it wasn't an easy to troubleshoot error (because no error was raised). Is...