Raphael Eisenhofer

icon indicating an email [email protected]

icon location Copenhagen, Denmark icon location Microbial ecologist and data scientsit at the Centre for Evolutionary Hologenomics, University of Copenhagen.

Results 6 comments of Raphael Eisenhofer

adapters not removed - mismatches insertion/deletion

Just thought I'd update this, as it would be nice if sequencing errors in the adapter sequences could be taken care of. Adapter used for R1: `AGATCGGAAGAGCACACGTCTGAACTCCAGTCA` All of these...

Output not just polymorphic sites:

@tseemann thanks for sending that through, I'll check it out!

Output not just polymorphic sites:

@tseemann I've given beast2_consites a spin, and it works great! However, in order to use it with Gubbins, I may need another approach. I noticed that the .gff file outputted...

Output not just polymorphic sites:

Thanks for the advice Torsten. For other people who may be interested, I ended up going with this approach: - Run gubbins on genome of interest - Use awk to...

Output not just polymorphic sites:

Yes, whoops, you're correct! > 4b. consider masking phage and plasmids too I'm using PHASTER for this, which seems to be working well.

[Question] --threshold and -k for ancient DNA

Dear Erik, No problem, thanks for responding! That makes sense. Do you have a script/markdown available to generate such a histogram -- such that I don't have to reinvent the...