Adaptor trimming

[tbazilegith]

Hi Yoshinori, I am trying to trim adaptors from ONT reads: Do we just use the flags --adapter_5 ADP5 --adapter_3 ADP3? I have used this: for s in $(cat samples_ont.txt);do longQC.py sampleqc -x ont-rapid -o ${today}OntQC_results/${s} LRfastqs/${s}.fastq.gz --adapter_5 ADP5 --adapter_3 ADP3 --trim_output ${today}OntQC_results --ncpu ${SLURM_CPUS_PER_TASK} done

• I keep having the error IsADirectoryError: Is a directory: '20220405OntQC_results/barcode02' Thanks, TJ

[yfukasawa]

Hi @tbazilegith,

Sorry for a late reply due to my schedule these days. Re. your query, let me clarify.

--adapter_5 and --adapter_3 options can be used when you'd like to remove non-default sequence(s), and expected input is a real sequence. Example would be --adapter_5 "ATATATGG", and LongQC will search ATATATGG in 5' end, and remove if it is detected. As you chose -x ont-rapid, the default behavior is finding and then trimming a below sequence from just 5' end: "GTTTTCGCATTTATCGTGAAACGCTTTCGCGTTTTTCGTGCGCCGCTTCA". No adapter search will be conducted for 3' end in ont-rapid if --adapter_3 option is not specified.

As I haven't followed ONT adapters for a while, kindly let me know if there have been some updates for ONT adapter. I'm happy to update sequence in a next version :)

Also, by default trimmed reads are not saved by LongQC. When you need such a file, please specify a path for trimmed read file using --trim_output option. I hope this helps.

Yoshinori