Please rename your contigs or use --centre XXX to generate clean contig names

[xapple]

So I just tried prokka on a file that contained one sequence as such:

>contig00001 length=455937 numreads=17237
AACTAACAACTAACAACCAACAACAAACCACTAACACATTTGTCTTTCTACAGCCGCTGG
ATCTTTCCCTATTTGATGGATATTGCGATGCGAGATTCGTTGTTCACGCGTCATCGGGTC
GGATTGCTGTCTGCTGTGAGGGGGGATGTGTTGGAAATCGGAGTCGGTACCGGATTGAAT
TTGAAGCATTATCCTGAGCAGACGACGCGGCTCAATGTAGTGGATTCCAATCCTGGAATG
AACGTGCTTCTGCGTCGCCGCATGAAGGGTATTCCATTTCCTGTGCAGCATGCCACAATC

The command:

~/programs/prokka111/bin/prokka --outdir output --cpus 4 --locustag prokka --compliant --usegenus --metagenome --addgene --quiet --force --centre XXX contig.fasta

And it complains with the error:

[02:13:14] Please rename your contigs or use --centre XXX to generate clean contig names.

How can this be bothersome for prokka ? It's just a header text, if it doesn't like it, it can just not read it. Or rename it by itself in memory. This is the kind of thing that just makes a product un-userfrienly. I don't really feel like renaming my hundred of thousands of contigs...

If I add, as suggested, --centre XXX to the command, I still get the same error.