iCount
iCount copied to clipboard
tomazc
iCount, protein-RNA interaction analytics
Hi, I've tried to install iCount through pip and I'm getting the following error. It is consistent across using pip or pip3 to install (my python versions are 2.7 &...
Is "Curk et al. (2019) iCount: protein-RNA interaction iCLIP data analysis (in preparation)." still the official way to cite iCount? We have cited it in our paper ["Assessing and assuring...
I am attempting to determine cross-linking site with mapped reads, but certain libraries seem to give the same warning about several second starts not falling along segmentation borders when no...
### _cutadapt with multiple threads_ **About** Cutadapt versions greater than or equal to `1.15` support multithreading, adding an option to run cutadapt in this mode. **Changes** This option is only...
--minimum_length with default value 15, the output fastq file also contained length 0 read. command: iCount demultiplex hnRNPC.fq.gz AGATCGGAAGAGCGGTTCAG NNNGGTTNN NNNTTGTNN \ NNNCAATNN NNNACCTNN NNNGGCGNN --out_dir "demultiplexed" result:  Thanks...
Hi, I keep coming across the following error, regardless if I generate a full genome index or an index for just two chromosomes (as in the tutorial). Any idea? I...
"Handle the case where randomer is already in the header." This did not include if the nucleotide after the rbc is an N, which it often is, meaning that you...
Hi, in order to process our D. melanogaster iCLIP library, I used snakemake to put the iCount steps together and integrated benchmarking, specifically for `iCount xlsites` with quantification based on...
I tried it with the ensemble annotation and I received the following error: Executing the following command: iCount segment Homo_sapiens.GRCh38.93.gtf Homo_sapiens.GRCh38.93.seg.gtf GRCh38.p7.genome.fa.fai Input parameters for function 'get_segments' in iCount.genomes.segment annotation:...
