Tobias Neumann

What I meant is to look in the readCount column of the `*tcount.tsv` files and check if there are reads counted or none at all. That would point to a...

If I compare the -v 3 output for the first read, it is already obvious that there is something off: ``` 6364be98-8dcf-4897-bac5-7a2f9def148a runid=03eec05c36f3e19a293608bac1f8877f948142e7 read=10580 ch=232 start_time=2018-09-14T15:47:19Z start: ATGTTGTGCCCCGTTCAATTTACGTATTGCTGAGTCTTGTGTCCCAGTTGCAGGGTGACTGGAGTTCAGGCAATGTGCTCTTCCGATCTGACTGGAGTTAGACGTATTAACTCTTCGGTCTGACTGGAGTTCAGACGTGTGCTCTTCCGA... start alignments:...

Unfortunately I haven't found any solution yet. I tried to look into his new thing based on fast5 files deepbinner (https://github.com/rrwick/Deepbinner) but the description says it was only trained for...

@callumparr Yes they are already listed, so that's not something that would help me.

Hi Isaac, absolutely, I was considering for a long time to also make SLAM-DUNK connectable with GRAND-SLAM and bakR but simply lacked the time and immediate need to get it...

What do you mean with parts of the library? In essence, I would forward you to @popitsch who is having some solutions for the Ameres lab in place for such...

Hm I would propably use the same pipeline for both sets to keep them comparable - for this Niko should be able to help, to map + quantify the reads...

Sorry for the delay in replying, I was on a course the whole week and will check it until next week

Hi @isaacvock so to get this right, you are getting the identical T>C conversions for each read from my code and your new cb code, but the T count is...

Hm that's a bit odd because for getting the Ts/As for a given read, we really simply take the read.sequence property from the pysam read object and count the Ts,...