sunbeam
sunbeam copied to clipboard
sunbeam-labs
test failed without obvious error
hi all, I've performed a local install of sunbeam on our cluster and received this as output from bash tests/run_tests.bash -d /home/bbrow6/tmp/
Running setup... ✔ Running build_test_data... ✔ Running test_all... ✔ Running test_all_old_illumina... ✔ Running test_assembly_failures... ✔ Running test_blank_fp_behavior... ✔ Running test_extensions... ✔ Running test_get_paired_unpaired... ✔ Running test_guess_with_inconsistent_samples... ✔ Running test_guess_with_index_files_present... ✔ Running test_guess_with_two_samples... ✔ Running test_mapping... Failed command error output: Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. Building DAG of jobs... Using shell: /usr/bin/bash Provided cores: 1 Rules claiming more threads will be scaled down. Job counts: count jobs 2 adapter_removal_paired 2 aggregate_reads 4 align_to_genome 2 align_to_host 1 all_mapping 4 filter_reads 2 find_low_complexity 2 get_mapped_reads 4 qc_final 4 remove_low_complexity 4 sample_intake 4 samtools_convert 4 samtools_get_coverage 4 samtools_index 4 samtools_mpileup 2 samtools_summarize_coverage 2 trimmomatic_paired 51
[Wed Apr 28 18:37:10 2021] rule sample_intake: input: /gpfs/home/bbrow6/tmp/data_files/PCMP_stub_human_R1.fastq.gz output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/00_samples/stub_human_1.fastq.gz jobid: 50 wildcards: sample=stub_human, rp=1
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 sample_intake 1[0m [Wed Apr 28 18:37:12 2021] Finished job 50. 1 of 51 steps (2%) done
[Wed Apr 28 18:37:12 2021] rule sample_intake: input: /gpfs/home/bbrow6/tmp/data_files/PCMP_stub_human_R2.fastq.gz output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/00_samples/stub_human_2.fastq.gz jobid: 51 wildcards: sample=stub_human, rp=2
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 sample_intake 1[0m [Wed Apr 28 18:37:14 2021] Finished job 51. 2 of 51 steps (4%) done
[Wed Apr 28 18:37:14 2021] rule adapter_removal_paired: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/00_samples/stub_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/00_samples/stub_human_2.fastq.gz output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub_human_2.fastq.gz log: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/log/cutadapt/stub_human.log jobid: 48 wildcards: sample=stub_human
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 adapter_removal_paired 1[0m gzip: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub_human_1.fastq.gz already has .gz suffix -- unchanged gzip: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub_human_2.fastq.gz already has .gz suffix -- unchanged [Wed Apr 28 18:37:16 2021] Finished job 48. 3 of 51 steps (6%) done
[Wed Apr 28 18:37:16 2021] rule trimmomatic_paired: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub_human_2.fastq.gz output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub_human_2.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/unpaired/stub_human_1_unpaired.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/unpaired/stub_human_2_unpaired.fastq.gz log: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/log/trimmomatic/stub_human.out jobid: 43 wildcards: sample=stub_human
TrimmomaticPE: Started with arguments: -threads 1 -phred33 /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub_human_1.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub_human_2.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub_human_1.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/unpaired/stub_human_1_unpaired.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub_human_2.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/unpaired/stub_human_2_unpaired.fastq.gz ILLUMINACLIP:/gpfs/home/bbrow6/miniconda3/envs/sunbeam-tmp/share/trimmomatic-0.36-6/adapters/NexteraPE-PE.fa:2:30:10:8:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG' Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG' Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG' Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC' Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA' ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences Input Read Pairs: 1 Both Surviving: 1 (100.00%) Forward Only Surviving: 0 (0.00%) Reverse Only Surviving: 0 (0.00%) Dropped: 0 (0.00%) TrimmomaticPE: Completed successfully Removing temporary output file /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/unpaired/stub_human_1_unpaired.fastq.gz. Removing temporary output file /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/unpaired/stub_human_2_unpaired.fastq.gz. [Wed Apr 28 18:37:16 2021] Finished job 43. 4 of 51 steps (8%) done
[Wed Apr 28 18:37:16 2021] rule find_low_complexity: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub_human_2.fastq.gz output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/log/komplexity/stub_human.filtered_ids jobid: 44 wildcards: sample=stub_human
[Wed Apr 28 18:37:16 2021] Finished job 44. 5 of 51 steps (10%) done
[Wed Apr 28 18:37:16 2021] rule remove_low_complexity: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/log/komplexity/stub_human.filtered_ids output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/03_komplexity/stub_human_1.fastq.gz jobid: 37 wildcards: sample=stub_human, rp=1
[Wed Apr 28 18:37:16 2021] Finished job 37. 6 of 51 steps (12%) done
[Wed Apr 28 18:37:16 2021] rule qc_final: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/03_komplexity/stub_human_1.fastq.gz output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub_human_1.fastq.gz jobid: 30 wildcards: sample=stub_human, rp=1
[Wed Apr 28 18:37:16 2021] Finished job 30. 7 of 51 steps (14%) done
[Wed Apr 28 18:37:16 2021] rule remove_low_complexity: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub_human_2.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/log/komplexity/stub_human.filtered_ids output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/03_komplexity/stub_human_2.fastq.gz jobid: 39 wildcards: sample=stub_human, rp=2
[Wed Apr 28 18:37:16 2021] Finished job 39. 8 of 51 steps (16%) done
[Wed Apr 28 18:37:16 2021] rule qc_final: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/03_komplexity/stub_human_2.fastq.gz output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub_human_2.fastq.gz jobid: 32 wildcards: sample=stub_human, rp=2
[Wed Apr 28 18:37:16 2021] Finished job 32. 9 of 51 steps (18%) done
[Wed Apr 28 18:37:16 2021] rule align_to_host: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub_human_2.fastq.gz, /gpfs/home/bbrow6/tmp/hosts/phix174.fasta.amb output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub_human.bam jobid: 38 wildcards: host=phix174, sample=stub_human
[M::bwa_idx_load_from_disk] read 0 ALT contigs [M::process] read 2 sequences (160 bp)... [M::mem_pestat] # candidate unique pairs for (FF, FR, RF, RR): (0, 0, 0, 0) [M::mem_pestat] skip orientation FF as there are not enough pairs [M::mem_pestat] skip orientation FR as there are not enough pairs [M::mem_pestat] skip orientation RF as there are not enough pairs [M::mem_pestat] skip orientation RR as there are not enough pairs [M::mem_process_seqs] Processed 2 reads in 0.001 CPU sec, 0.000 real sec [main] Version: 0.7.17-r1188 [main] CMD: bwa mem -M -t 1 -o /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub_human.sam /gpfs/home/bbrow6/tmp/hosts/phix174.fasta /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub_human_1.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub_human_2.fastq.gz [main] Real time: 0.006 sec; CPU: 0.003 sec [Wed Apr 28 18:37:16 2021] Finished job 38. 10 of 51 steps (20%) done
[Wed Apr 28 18:37:16 2021] rule get_mapped_reads: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub_human.bam output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub_human.ids jobid: 31 wildcards: host=phix174, sample=stub_human
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 get_mapped_reads 1[0m [E::idx_find_and_load] Could not retrieve index file for '/gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub_human.bam' Removing temporary output file /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub_human.bam. [Wed Apr 28 18:37:18 2021] Finished job 31. 11 of 51 steps (22%) done
[Wed Apr 28 18:37:18 2021] rule sample_intake: input: /gpfs/home/bbrow6/tmp/data_files/PCMP_stub2_human_R1.fastq.gz output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/00_samples/stub2_human_1.fastq.gz jobid: 52 wildcards: sample=stub2_human, rp=1
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 sample_intake 1[0m [Wed Apr 28 18:37:19 2021] Finished job 52. 12 of 51 steps (24%) done
[Wed Apr 28 18:37:19 2021] rule sample_intake: input: /gpfs/home/bbrow6/tmp/data_files/PCMP_stub2_human_R2.fastq.gz output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/00_samples/stub2_human_2.fastq.gz jobid: 53 wildcards: sample=stub2_human, rp=2
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 sample_intake 1[0m [Wed Apr 28 18:37:20 2021] Finished job 53. 13 of 51 steps (25%) done
[Wed Apr 28 18:37:20 2021] rule adapter_removal_paired: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/00_samples/stub2_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/00_samples/stub2_human_2.fastq.gz output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub2_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub2_human_2.fastq.gz log: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/log/cutadapt/stub2_human.log jobid: 49 wildcards: sample=stub2_human
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 adapter_removal_paired 1[0m gzip: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub2_human_1.fastq.gz already has .gz suffix -- unchanged gzip: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub2_human_2.fastq.gz already has .gz suffix -- unchanged [Wed Apr 28 18:37:22 2021] Finished job 49. 14 of 51 steps (27%) done
[Wed Apr 28 18:37:22 2021] rule trimmomatic_paired: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub2_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub2_human_2.fastq.gz output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub2_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub2_human_2.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/unpaired/stub2_human_1_unpaired.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/unpaired/stub2_human_2_unpaired.fastq.gz log: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/log/trimmomatic/stub2_human.out jobid: 46 wildcards: sample=stub2_human
TrimmomaticPE: Started with arguments: -threads 1 -phred33 /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub2_human_1.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/01_cutadapt/stub2_human_2.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub2_human_1.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/unpaired/stub2_human_1_unpaired.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub2_human_2.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/unpaired/stub2_human_2_unpaired.fastq.gz ILLUMINACLIP:/gpfs/home/bbrow6/miniconda3/envs/sunbeam-tmp/share/trimmomatic-0.36-6/adapters/NexteraPE-PE.fa:2:30:10:8:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG' Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG' Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG' Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC' Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA' ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences Input Read Pairs: 1 Both Surviving: 1 (100.00%) Forward Only Surviving: 0 (0.00%) Reverse Only Surviving: 0 (0.00%) Dropped: 0 (0.00%) TrimmomaticPE: Completed successfully Removing temporary output file /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/unpaired/stub2_human_1_unpaired.fastq.gz. Removing temporary output file /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/unpaired/stub2_human_2_unpaired.fastq.gz. [Wed Apr 28 18:37:23 2021] Finished job 46. 15 of 51 steps (29%) done
[Wed Apr 28 18:37:23 2021] rule find_low_complexity: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub2_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub2_human_2.fastq.gz output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/log/komplexity/stub2_human.filtered_ids jobid: 47 wildcards: sample=stub2_human
[Wed Apr 28 18:37:23 2021] Finished job 47. 16 of 51 steps (31%) done
[Wed Apr 28 18:37:23 2021] rule remove_low_complexity: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub2_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/log/komplexity/stub2_human.filtered_ids output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/03_komplexity/stub2_human_1.fastq.gz jobid: 40 wildcards: sample=stub2_human, rp=1
[Wed Apr 28 18:37:23 2021] Finished job 40. 17 of 51 steps (33%) done
[Wed Apr 28 18:37:23 2021] rule qc_final: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/03_komplexity/stub2_human_1.fastq.gz output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub2_human_1.fastq.gz jobid: 34 wildcards: sample=stub2_human, rp=1
[Wed Apr 28 18:37:23 2021] Finished job 34. 18 of 51 steps (35%) done
[Wed Apr 28 18:37:23 2021] rule remove_low_complexity: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/02_trimmomatic/stub2_human_2.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/log/komplexity/stub2_human.filtered_ids output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/03_komplexity/stub2_human_2.fastq.gz jobid: 42 wildcards: sample=stub2_human, rp=2
[Wed Apr 28 18:37:23 2021] Finished job 42. 19 of 51 steps (37%) done
[Wed Apr 28 18:37:23 2021] rule qc_final: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/03_komplexity/stub2_human_2.fastq.gz output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub2_human_2.fastq.gz jobid: 36 wildcards: sample=stub2_human, rp=2
[Wed Apr 28 18:37:23 2021] Finished job 36. 20 of 51 steps (39%) done
[Wed Apr 28 18:37:23 2021] rule align_to_host: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub2_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub2_human_2.fastq.gz, /gpfs/home/bbrow6/tmp/hosts/phix174.fasta.amb output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub2_human.bam jobid: 41 wildcards: host=phix174, sample=stub2_human
[M::bwa_idx_load_from_disk] read 0 ALT contigs [M::process] read 2 sequences (80 bp)... [M::mem_pestat] # candidate unique pairs for (FF, FR, RF, RR): (0, 0, 0, 0) [M::mem_pestat] skip orientation FF as there are not enough pairs [M::mem_pestat] skip orientation FR as there are not enough pairs [M::mem_pestat] skip orientation RF as there are not enough pairs [M::mem_pestat] skip orientation RR as there are not enough pairs [M::mem_process_seqs] Processed 2 reads in 0.001 CPU sec, 0.000 real sec [main] Version: 0.7.17-r1188 [main] CMD: bwa mem -M -t 1 -o /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub2_human.sam /gpfs/home/bbrow6/tmp/hosts/phix174.fasta /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub2_human_1.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub2_human_2.fastq.gz [main] Real time: 0.005 sec; CPU: 0.003 sec [Wed Apr 28 18:37:23 2021] Finished job 41. 21 of 51 steps (41%) done
[Wed Apr 28 18:37:23 2021] rule get_mapped_reads: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub2_human.bam output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub2_human.ids jobid: 35 wildcards: host=phix174, sample=stub2_human
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 get_mapped_reads 1[0m [E::idx_find_and_load] Could not retrieve index file for '/gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub2_human.bam' Removing temporary output file /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub2_human.bam. [Wed Apr 28 18:37:25 2021] Finished job 35. 22 of 51 steps (43%) done
[Wed Apr 28 18:37:25 2021] rule aggregate_reads: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub_human.ids output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/stub_human_hostreads.ids jobid: 29 wildcards: sample=stub_human
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 aggregate_reads 1[0m [Wed Apr 28 18:37:26 2021] Finished job 29. 23 of 51 steps (45%) done
[Wed Apr 28 18:37:26 2021] rule filter_reads: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/stub_human_hostreads.ids, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub_human.ids output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/log/decontam/stub_human_1.txt jobid: 23 wildcards: sample=stub_human, rp=1
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 filter_reads 1[0m [Wed Apr 28 18:37:27 2021] Finished job 23. 24 of 51 steps (47%) done
[Wed Apr 28 18:37:27 2021] rule filter_reads: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/stub_human_hostreads.ids, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub_human_2.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub_human.ids output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub_human_2.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/log/decontam/stub_human_2.txt jobid: 24 wildcards: sample=stub_human, rp=2
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 filter_reads 1[0m Removing temporary output file /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/stub_human_hostreads.ids. [Wed Apr 28 18:37:29 2021] Finished job 24. 25 of 51 steps (49%) done
[Wed Apr 28 18:37:29 2021] rule align_to_genome: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub_human_2.fastq.gz, /gpfs/home/bbrow6/tmp/indexes/human.fasta.amb output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/human/stub_human.sam jobid: 19 wildcards: genome=human, sample=stub_human
[M::bwa_idx_load_from_disk] read 0 ALT contigs [M::process] read 2 sequences (160 bp)... [M::mem_pestat] # candidate unique pairs for (FF, FR, RF, RR): (0, 1, 0, 0) [M::mem_pestat] skip orientation FF as there are not enough pairs [M::mem_pestat] skip orientation FR as there are not enough pairs [M::mem_pestat] skip orientation RF as there are not enough pairs [M::mem_pestat] skip orientation RR as there are not enough pairs [M::mem_process_seqs] Processed 2 reads in 0.001 CPU sec, 0.001 real sec [main] Version: 0.7.17-r1188 [main] CMD: bwa mem -M -t 1 -o /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/human/stub_human.sam /gpfs/home/bbrow6/tmp/indexes/human.fasta /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub_human_1.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub_human_2.fastq.gz [main] Real time: 0.008 sec; CPU: 0.003 sec [Wed Apr 28 18:37:29 2021] Finished job 19. 26 of 51 steps (51%) done
[Wed Apr 28 18:37:29 2021] rule samtools_convert: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/human/stub_human.sam output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub_human.bam jobid: 11 wildcards: genome=human, sample=stub_human
Removing temporary output file /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/human/stub_human.sam. [Wed Apr 28 18:37:29 2021] Finished job 11. 27 of 51 steps (53%) done
[Wed Apr 28 18:37:29 2021] rule samtools_mpileup: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub_human.bam, /gpfs/home/bbrow6/tmp/indexes/human.fasta output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub_human.raw.bcf jobid: 5 wildcards: genome=human, sample=stub_human
[warning] samtools mpileup option g is functional, but deprecated. Please switch to using bcftools mpileup in future.
[mpileup] 1 samples in 1 input files
Note: none of --samples-file, --ploidy or --ploidy-file given, assuming all sites are diploid
[Wed Apr 28 18:37:29 2021]
Finished job 5.
28 of 51 steps (55%) done
[Wed Apr 28 18:37:29 2021] rule samtools_get_coverage: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub_human.bam output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/human/stub_human.csv jobid: 16 wildcards: genome=human, sample=stub_human
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 samtools_get_coverage 1[0m [Wed Apr 28 18:37:31 2021] Finished job 16. 29 of 51 steps (57%) done
[Wed Apr 28 18:37:31 2021] rule samtools_index: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub_human.bam output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub_human.bam.bai jobid: 1 wildcards: genome=human, sample=stub_human
[Wed Apr 28 18:37:31 2021] Finished job 1. 30 of 51 steps (59%) done
[Wed Apr 28 18:37:31 2021] rule align_to_genome: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub_human_2.fastq.gz, /gpfs/home/bbrow6/tmp/indexes/phix174.fasta.amb output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/phix174/stub_human.sam jobid: 21 wildcards: genome=phix174, sample=stub_human
[M::bwa_idx_load_from_disk] read 0 ALT contigs [M::process] read 2 sequences (160 bp)... [M::mem_pestat] # candidate unique pairs for (FF, FR, RF, RR): (0, 0, 0, 0) [M::mem_pestat] skip orientation FF as there are not enough pairs [M::mem_pestat] skip orientation FR as there are not enough pairs [M::mem_pestat] skip orientation RF as there are not enough pairs [M::mem_pestat] skip orientation RR as there are not enough pairs [M::mem_process_seqs] Processed 2 reads in 0.001 CPU sec, 0.002 real sec [main] Version: 0.7.17-r1188 [main] CMD: bwa mem -M -t 1 -o /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/phix174/stub_human.sam /gpfs/home/bbrow6/tmp/indexes/phix174.fasta /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub_human_1.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub_human_2.fastq.gz [main] Real time: 0.009 sec; CPU: 0.003 sec [Wed Apr 28 18:37:31 2021] Finished job 21. 31 of 51 steps (61%) done
[Wed Apr 28 18:37:31 2021] rule samtools_convert: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/phix174/stub_human.sam output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub_human.bam jobid: 13 wildcards: genome=phix174, sample=stub_human
Removing temporary output file /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/phix174/stub_human.sam. [Wed Apr 28 18:37:31 2021] Finished job 13. 32 of 51 steps (63%) done
[Wed Apr 28 18:37:31 2021] rule samtools_mpileup: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub_human.bam, /gpfs/home/bbrow6/tmp/indexes/phix174.fasta output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub_human.raw.bcf jobid: 7 wildcards: genome=phix174, sample=stub_human
[warning] samtools mpileup option g is functional, but deprecated. Please switch to using bcftools mpileup in future.
[mpileup] 1 samples in 1 input files
Note: none of --samples-file, --ploidy or --ploidy-file given, assuming all sites are diploid
[Wed Apr 28 18:37:31 2021]
Finished job 7.
33 of 51 steps (65%) done
[Wed Apr 28 18:37:31 2021] rule samtools_get_coverage: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub_human.bam output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/phix174/stub_human.csv jobid: 18 wildcards: genome=phix174, sample=stub_human
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 samtools_get_coverage 1[0m [Wed Apr 28 18:37:33 2021] Finished job 18. 34 of 51 steps (67%) done
[Wed Apr 28 18:37:33 2021] rule samtools_index: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub_human.bam output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub_human.bam.bai jobid: 3 wildcards: genome=phix174, sample=stub_human
[Wed Apr 28 18:37:33 2021] Finished job 3. 35 of 51 steps (69%) done
[Wed Apr 28 18:37:33 2021] rule aggregate_reads: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub2_human.ids output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/stub2_human_hostreads.ids jobid: 33 wildcards: sample=stub2_human
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 aggregate_reads 1[0m [Wed Apr 28 18:37:34 2021] Finished job 33. 36 of 51 steps (71%) done
[Wed Apr 28 18:37:34 2021] rule filter_reads: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/stub2_human_hostreads.ids, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub2_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub2_human.ids output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub2_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/log/decontam/stub2_human_1.txt jobid: 26 wildcards: sample=stub2_human, rp=1
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 filter_reads 1[0m [Wed Apr 28 18:37:36 2021] Finished job 26. 37 of 51 steps (73%) done
[Wed Apr 28 18:37:36 2021] rule filter_reads: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/stub2_human_hostreads.ids, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/cleaned/stub2_human_2.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/phix174/stub2_human.ids output: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub2_human_2.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/log/decontam/stub2_human_2.txt jobid: 27 wildcards: sample=stub2_human, rp=2
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 filter_reads 1[0m Removing temporary output file /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/intermediates/stub2_human_hostreads.ids. [Wed Apr 28 18:37:37 2021] Finished job 27. 38 of 51 steps (75%) done
[Wed Apr 28 18:37:37 2021] rule align_to_genome: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub2_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub2_human_2.fastq.gz, /gpfs/home/bbrow6/tmp/indexes/human.fasta.amb output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/human/stub2_human.sam jobid: 20 wildcards: genome=human, sample=stub2_human
[M::bwa_idx_load_from_disk] read 0 ALT contigs [M::process] read 2 sequences (80 bp)... [M::mem_pestat] # candidate unique pairs for (FF, FR, RF, RR): (0, 1, 0, 0) [M::mem_pestat] skip orientation FF as there are not enough pairs [M::mem_pestat] skip orientation FR as there are not enough pairs [M::mem_pestat] skip orientation RF as there are not enough pairs [M::mem_pestat] skip orientation RR as there are not enough pairs [M::mem_process_seqs] Processed 2 reads in 0.001 CPU sec, 0.001 real sec [main] Version: 0.7.17-r1188 [main] CMD: bwa mem -M -t 1 -o /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/human/stub2_human.sam /gpfs/home/bbrow6/tmp/indexes/human.fasta /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub2_human_1.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub2_human_2.fastq.gz [main] Real time: 0.007 sec; CPU: 0.004 sec [Wed Apr 28 18:37:37 2021] Finished job 20. 39 of 51 steps (76%) done
[Wed Apr 28 18:37:37 2021] rule samtools_convert: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/human/stub2_human.sam output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub2_human.bam jobid: 12 wildcards: genome=human, sample=stub2_human
Removing temporary output file /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/human/stub2_human.sam. [Wed Apr 28 18:37:37 2021] Finished job 12. 40 of 51 steps (78%) done
[Wed Apr 28 18:37:37 2021] rule samtools_mpileup: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub2_human.bam, /gpfs/home/bbrow6/tmp/indexes/human.fasta output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub2_human.raw.bcf jobid: 6 wildcards: genome=human, sample=stub2_human
[warning] samtools mpileup option g is functional, but deprecated. Please switch to using bcftools mpileup in future.
[mpileup] 1 samples in 1 input files
Note: none of --samples-file, --ploidy or --ploidy-file given, assuming all sites are diploid
[Wed Apr 28 18:37:37 2021]
Finished job 6.
41 of 51 steps (80%) done
[Wed Apr 28 18:37:37 2021] rule samtools_get_coverage: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub2_human.bam output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/human/stub2_human.csv jobid: 15 wildcards: genome=human, sample=stub2_human
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 samtools_get_coverage 1[0m [Wed Apr 28 18:37:39 2021] Finished job 15. 42 of 51 steps (82%) done
[Wed Apr 28 18:37:39 2021] rule samtools_index: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub2_human.bam output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub2_human.bam.bai jobid: 2 wildcards: genome=human, sample=stub2_human
[Wed Apr 28 18:37:39 2021] Finished job 2. 43 of 51 steps (84%) done
[Wed Apr 28 18:37:39 2021] rule samtools_summarize_coverage: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/human/stub2_human.csv, /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/human/stub_human.csv output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/coverage.csv jobid: 9 wildcards: genome=human
[Wed Apr 28 18:37:39 2021] Finished job 9. 44 of 51 steps (86%) done
[Wed Apr 28 18:37:39 2021] rule align_to_genome: input: /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub2_human_1.fastq.gz, /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub2_human_2.fastq.gz, /gpfs/home/bbrow6/tmp/indexes/phix174.fasta.amb output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/phix174/stub2_human.sam jobid: 22 wildcards: genome=phix174, sample=stub2_human
[M::bwa_idx_load_from_disk] read 0 ALT contigs [M::process] read 2 sequences (80 bp)... [M::mem_pestat] # candidate unique pairs for (FF, FR, RF, RR): (0, 0, 0, 0) [M::mem_pestat] skip orientation FF as there are not enough pairs [M::mem_pestat] skip orientation FR as there are not enough pairs [M::mem_pestat] skip orientation RF as there are not enough pairs [M::mem_pestat] skip orientation RR as there are not enough pairs [M::mem_process_seqs] Processed 2 reads in 0.001 CPU sec, 0.002 real sec [main] Version: 0.7.17-r1188 [main] CMD: bwa mem -M -t 1 -o /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/phix174/stub2_human.sam /gpfs/home/bbrow6/tmp/indexes/phix174.fasta /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub2_human_1.fastq.gz /gpfs/home/bbrow6/tmp/sunbeam_output/qc/decontam/stub2_human_2.fastq.gz [main] Real time: 0.011 sec; CPU: 0.003 sec [Wed Apr 28 18:37:39 2021] Finished job 22. 45 of 51 steps (88%) done
[Wed Apr 28 18:37:39 2021] rule samtools_convert: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/phix174/stub2_human.sam output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub2_human.bam jobid: 14 wildcards: genome=phix174, sample=stub2_human
Removing temporary output file /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/phix174/stub2_human.sam. [Wed Apr 28 18:37:39 2021] Finished job 14. 46 of 51 steps (90%) done
[Wed Apr 28 18:37:39 2021] rule samtools_mpileup: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub2_human.bam, /gpfs/home/bbrow6/tmp/indexes/phix174.fasta output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub2_human.raw.bcf jobid: 8 wildcards: genome=phix174, sample=stub2_human
[warning] samtools mpileup option g is functional, but deprecated. Please switch to using bcftools mpileup in future.
[mpileup] 1 samples in 1 input files
Note: none of --samples-file, --ploidy or --ploidy-file given, assuming all sites are diploid
[Wed Apr 28 18:37:40 2021]
Finished job 8.
47 of 51 steps (92%) done
[Wed Apr 28 18:37:40 2021] rule samtools_index: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub2_human.bam output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub2_human.bam.bai jobid: 4 wildcards: genome=phix174, sample=stub2_human
[Wed Apr 28 18:37:40 2021] Finished job 4. 48 of 51 steps (94%) done
[Wed Apr 28 18:37:40 2021] rule samtools_get_coverage: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub2_human.bam output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/phix174/stub2_human.csv jobid: 17 wildcards: genome=phix174, sample=stub2_human
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 samtools_get_coverage 1[0m [Wed Apr 28 18:37:41 2021] Finished job 17. 49 of 51 steps (96%) done
[Wed Apr 28 18:37:41 2021] rule samtools_summarize_coverage: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/phix174/stub2_human.csv, /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/intermediates/phix174/stub_human.csv output: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/coverage.csv jobid: 10 wildcards: genome=phix174
[Wed Apr 28 18:37:41 2021] Finished job 10. 50 of 51 steps (98%) done
[Wed Apr 28 18:37:41 2021] localrule all_mapping: input: /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub_human.bam.bai, /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub2_human.bam.bai, /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub_human.bam.bai, /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub2_human.bam.bai, /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub_human.raw.bcf, /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/stub2_human.raw.bcf, /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub_human.raw.bcf, /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/stub2_human.raw.bcf, /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/human/coverage.csv, /gpfs/home/bbrow6/tmp/sunbeam_output/mapping/phix174/coverage.csv jobid: 0
[Wed Apr 28 18:37:41 2021] Finished job 0. 51 of 51 steps (100%) done Complete log: /gpfs/home/bbrow6/apps/sunbeam-stable/.snakemake/log/2021-04-28T183709.362760.snakemake.log x (log: /home/bbrow6/tmp/test_mapping.[out/err]) -- TESTS FAILED --
where the content of that error file is the laundry list above, repeated.
ideas?
thanks! b
Hi @itsmisterbrown, try using the dev branch instead of the stable branch, so, something like this:
git clone -b dev https://github.com/sunbeam-labs/sunbeam sunbeam-dev
cd sunbeam-dev
./install.sh
tests/run_tests.bash -e sunbeam
@louiejtaylor and folks, I think this is one of the problems fixed in #290 (the coverage.csv checks in test_mapping) that just needs to get merged into a new stable version.
@ressy thanks for the speedy reply. I reinstalled with the dev branch and it threw this error after running tests/run_tests.bash -e sunbeam -d /home/bbrow6/tmp/dev_test_042921/
and the end of the error file starting at the rule report read:
rule kraken2_classify_report: input: /gpfs/home/bbrow6/tmp/dev_test_042921/sunbeam_output/qc/decontam/dummyecoli_1.fastq.gz, /gpfs/home/bbrow6/tmp/dev _test_042921/sunbeam_output/qc/decontam/dummyecoli_2.fastq.gz output: /gpfs/home/bbrow6/tmp/dev_test_042921/sunbeam_output/classify/kraken/raw/dummyecoli-raw.tsv, /gpfs/home/bbrow6/t mp/dev_test_042921/sunbeam_output/classify/kraken/dummyecoli-taxa.tsv jobid: 99 wildcards: sample=dummyecoli kraken2 --gzip-compressed --db /gpfs/home/bbrow6/tmp/dev_test_042921/mindb --report /gpfs/home/bbrow6/tmp/dev_test_042921/sunbeam_output/classify/kraken/dummyecoli-taxa.tsv --paired /gpfs/home /bbrow6/tmp/dev_test_042921/sunbeam_output/qc/decontam/dummyecoli_1.fastq.gz /gpfs/home/bbrow6/tmp/dev_test_042921/sunbeam_o utput/qc/decontam/dummyecoli_2.fastq.gz > /gpfs/home/bbrow6/tmp/dev_test_042921/sunbeam_output/classify/krak en/raw/dummyecoli-raw.tsv
Loading database information... done. /usr/bin/bash: line 1: 26312 Segmentation fault (core dumped) kraken2 --gzip-compressed --db /gpfs/home/bbrow6/tmp/dev_ test_042921/mindb --report /gpfs/home/bbrow6/tmp/dev_test_042921/sunbeam_output/classify/kraken/dummyecoli-taxa.tsv --paired /gpfs/home/bbrow6/tmp/dev_test_042921/sunbeam_output/qc/decontam/dummyecoli_1.fastq.gz /gpfs/home/bbrow6/tmp/dev_test_04292 1/sunbeam_output/qc/decontam/dummyecoli_2.fastq.gz > /gpfs/home/bbrow6/tmp/dev_test_042921/sunbeam_output/classify/kraken/ra w/dummyecoli-raw.tsv [Thu Apr 29 13:31:01 2021] Error in rule kraken2_classify_report: jobid: 99 output: /gpfs/home/bbrow6/tmp/dev_test_042921/sunbeam_output/classify/kraken/raw/dummyecoli-raw.tsv, /gpfs/home/bbrow6/t mp/dev_test_042921/sunbeam_output/classify/kraken/dummyecoli-taxa.tsv shell:
kraken2 --gzip-compressed --db /gpfs/home/bbrow6/tmp/dev_test_042921/mindb --report
/gpfs/home/bbrow6/tmp/dev_test_042921/sunbeam_output/classify/kraken/dummyecoli-taxa.tsv --paired /gpfs/home /bbrow6/tmp/dev_test_042921/sunbeam_output/qc/decontam/dummyecoli_1.fastq.gz /gpfs/home/bbrow6/tmp/dev_test_042921/sunbeam_o utput/qc/decontam/dummyecoli_2.fastq.gz > /gpfs/home/bbrow6/tmp/dev_test_042921/sunbeam_output/classify/krak en/raw/dummyecoli-raw.tsv
(exited with non-zero exit code)
Removing output files of failed job kraken2_classify_report since they might be corrupted: /gpfs/home/bbrow6/tmp/dev_test_042921/sunbeam_output/classify/kraken/raw/dummyecoli-raw.tsv Shutting down, this might take some time. Exiting because a job execution failed. Look above for error message
The segmentation fault in kraken2 could be from a few different things. Are you running this on a cluster (Maybe LSF I'm guessing from the /gpfs path)? One thing to check is that enough memory is available. Also make sure you have read access to the database. (I expect you do since it's in your home directory, but we recently had a user mention a segmentation fault in kraken2 due to that, so it couldn't hurt to check!)
@ressy thanks, so I was able to get around the segmentation issue with more memory allocation (now ~486G), but now megahit isn't playing nice. The test_all.err file listed:
Found extension sbx_test_subdir in folder sbx_test_subdir Found extension sbx_test in folder sbx_test Found extension sbx_test_smk in folder sbx_test_smk Collecting host/contaminant genomes... done. Collecting target genomes... done. [33mJob counts: count jobs 1 samtools_get_coverage 1[0m [Thu Apr 29 14:29:04 2021] Finished job 81. 61 of 127 steps (48%) done
[Thu Apr 29 14:29:04 2021] rule megahit_paired: input: /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/qc/decontam/dummybfragilis_1.fastq.gz, /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/qc/decontam/dummybfragilis_2.fastq.gz output: /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm/final.contigs.fa jobid: 62 wildcards: sample=dummybfragilis
## turn off bash strict mode
set +o pipefail
## sometimes the error is due to lack of memory
exitcode=0
megahit -t 1 -1 /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/qc/decontam/dummybfragilis_1.fastq.gz -2 /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/qc/decontam/dummybfragilis_2.fastq.gz -o /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm --continue || exitcode=$?
if [ $exitcode -eq 255 ]
then
echo "Empty contigs"
touch /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm/final.contigs.fa
elif [ $exitcode -gt 1 ]
then
echo "Check your memory"
fi
Cannot find /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm/opts.txt Please check whether the output directory is correctly set by "-o" Now switching to normal mode. 503.805Gb memory in total. Using: 453.424Gb. MEGAHIT v1.1.3 --- [Thu Apr 29 14:29:04 2021] Start assembly. Number of CPU threads 1 --- --- [Thu Apr 29 14:29:04 2021] Available memory: 540956049408, used: 486860444467 --- [Thu Apr 29 14:29:04 2021] Converting reads to binaries --- b' [read_lib_functions-inl.h : 209] Lib 0 (/active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/qc/decontam/dummybfragilis_1.fastq.gz,/active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/qc/decontam/dummybfragilis_2.fastq.gz): pe, 1228 reads, 250 max length' b' [utils.h : 126] Real: 0.0123\tuser: 0.0021\tsys: 0.0021\tmaxrss: 10792' --- [Thu Apr 29 14:29:04 2021] k list: 21,29,39,59,79,99,119,141 --- --- [Thu Apr 29 14:29:04 2021] Extracting solid (k+1)-mers for k = 21 --- --- [Thu Apr 29 14:29:04 2021] Building graph for k = 21 --- --- [Thu Apr 29 14:29:05 2021] Assembling contigs from SdBG for k = 21 --- Error occurs when assembling contigs for k = 21, please refer to /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm/log for detail [Exit code -11] Waiting at most 5 seconds for missing files. MissingOutputException in line 14 of /gpfs/home/bbrow6/apps/sunbeam-dev/rules/assembly/assembly.smk: Missing files after 5 seconds: /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm/final.contigs.fa This might be due to filesystem latency. If that is the case, consider to increase the wait time with --latency-wait. Shutting down, this might take some time. Exiting because a job execution failed. Look above for error message Complete log: /gpfs/home/bbrow6/apps/sunbeam-dev/.snakemake/log/2021-04-29T142812.925202.snakemake.log
and when I dug into the log file bolded above, I get:
MEGAHIT v1.1.3 --- [Thu Apr 29 14:29:04 2021] Start assembly. Number of CPU threads 1 --- --- [Thu Apr 29 14:29:04 2021] Available memory: 540956049408, used: 486860444467 --- [Thu Apr 29 14:29:04 2021] Converting reads to binaries --- /gpfs/home/bbrow6/miniconda3/envs/sunbeam/bin/megahit_asm_core buildlib /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm/tmp/reads.lib /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm/tmp/reads.lib b' [read_lib_functions-inl.h : 209] Lib 0 (/active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/qc/decontam/dummybfragilis_1.fastq.gz,/active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/qc/decontam/dummybfragilis_2.fastq.gz): pe, 1228 reads, 250 max length' b' [utils.h : 126] Real: 0.0123\tuser: 0.0021\tsys: 0.0021\tmaxrss: 10792' --- [Thu Apr 29 14:29:04 2021] k list: 21,29,39,59,79,99,119,141 --- --- [Thu Apr 29 14:29:04 2021] Extracting solid (k+1)-mers for k = 21 --- cmd: /gpfs/home/bbrow6/miniconda3/envs/sunbeam/bin/megahit_sdbg_build count -k 21 -m 2 --host_mem 486860444467 --mem_flag 1 --gpu_mem 0 --output_prefix /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm/tmp/k21/21 --num_cpu_threads 1 --num_output_threads 1 --read_lib_file /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm/tmp/reads.lib b' [sdbg_builder.cpp : 112] Host memory to be used: 486860444467' b' [sdbg_builder.cpp : 113] Number CPU threads: 1' b' [cx1.h : 450] Preparing data...' b' [read_lib_functions-inl.h : 256] Before reading, sizeof seq_package: 86584' b' [read_lib_functions-inl.h : 260] After reading, sizeof seq_package: 86584' b' [cx1_kmer_count.cpp : 136] 1228 reads, 250 max read length' b' [cx1.h : 457] Preparing data... Done. Time elapsed: 0.0021' b' [cx1.h : 464] Preparing partitions and initialing global data...' b' [cx1_kmer_count.cpp : 227] 2 words per substring, 2 words per edge' b' [cx1_kmer_count.cpp : 322] Set: 156936, 486856682987' b' [cx1_kmer_count.cpp : 356] 37494, 290 156936 486856682987' b' [cx1_kmer_count.cpp : 363] Memory for reads: 89008' b' [cx1_kmer_count.cpp : 364] max # lv.1 items = 37494' b' [cx1.h : 480] Preparing partitions and initialing global data... Done. Time elapsed: 0.0266' b' [cx1.h : 486] Start main loop...' b' [cx1.h : 515] Lv1 scanning from bucket 0 to 404' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0043' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0046' b' [cx1.h : 515] Lv1 scanning from bucket 404 to 1081' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0041' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0027' b' [cx1.h : 515] Lv1 scanning from bucket 1081 to 1858' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0040' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0022' b' [cx1.h : 515] Lv1 scanning from bucket 1858 to 2688' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0040' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0022' b' [cx1.h : 515] Lv1 scanning from bucket 2688 to 3604' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0040' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0022' b' [cx1.h : 515] Lv1 scanning from bucket 3604 to 4693' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0040' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0023' b' [cx1.h : 515] Lv1 scanning from bucket 4693 to 6477' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0041' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0024' b' [cx1.h : 515] Lv1 scanning from bucket 6477 to 65536' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0044' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0014' b' [cx1.h : 607] Main loop done. Time elapsed: 0.0532' b' [cx1.h : 613] Postprocessing...' b' [cx1_kmer_count.cpp : 860] Total number of candidate reads: 1(1)' b' [cx1_kmer_count.cpp : 871] Total number of solid edges: 9227' b' [cx1.h : 621] Postprocess done. Time elapsed: 0.0483' b' [utils.h : 126] Real: 0.1305\tuser: 0.0909\tsys: 0.0109\tmaxrss: 10804' --- [Thu Apr 29 14:29:04 2021] Building graph for k = 21 --- /gpfs/home/bbrow6/miniconda3/envs/sunbeam/bin/megahit_sdbg_build seq2sdbg --host_mem 486860444467 --mem_flag 1 --gpu_mem 0 --output_prefix /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm/tmp/k21/21 --num_cpu_threads 1 -k 21 --kmer_from 0 --num_edge_files 1 --input_prefix /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm/tmp/k21/21 --need_mercy b' [sdbg_builder.cpp : 339] Host memory to be used: 486860444467' b' [sdbg_builder.cpp : 340] Number CPU threads: 1' b' [cx1.h : 450] Preparing data...' b' [cx1_seq2sdbg.cpp : 394] Number edges: 9227' b' [cx1_seq2sdbg.cpp : 434] Bases to reserve: 253726, number contigs: 0, number multiplicity: 11533' b' [cx1_seq2sdbg.cpp : 440] Before reading, sizeof seq_package: 63440, multiplicity vector: 11533' b' [cx1_seq2sdbg.cpp : 455] Adding mercy edges...' b' [cx1_seq2sdbg.cpp : 373] Number of reads: 1, Number of mercy edges: 32' b' [cx1_seq2sdbg.cpp : 462] Done. Time elapsed: 0.1579' b' [cx1_seq2sdbg.cpp : 529] After reading, sizeof seq_package: 63440, multiplicity vector: 11533' b' [cx1.h : 457] Preparing data... Done. Time elapsed: 0.2077' b' [cx1.h : 464] Preparing partitions and initialing global data...' b' [cx1_seq2sdbg.cpp : 740] Memory for sequence: 83574' b' [cx1_seq2sdbg.cpp : 741] max # lv.1 items = 7407' b' [cx1.h : 480] Preparing partitions and initialing global data... Done. Time elapsed: 0.0254' b' [cx1.h : 486] Start main loop...' b' [cx1.h : 515] Lv1 scanning from bucket 0 to 897' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0008' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0010' b' [cx1.h : 515] Lv1 scanning from bucket 897 to 2141' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0006' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0012' b' [cx1.h : 515] Lv1 scanning from bucket 2141 to 3891' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0006' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0010' b' [cx1.h : 515] Lv1 scanning from bucket 3891 to 6384' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0006' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0011' b' [cx1.h : 515] Lv1 scanning from bucket 6384 to 8877' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0006' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0012' b' [cx1.h : 515] Lv1 scanning from bucket 8877 to 11370' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0006' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0010' b' [cx1.h : 515] Lv1 scanning from bucket 11370 to 13863' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0006' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0012' b' [cx1.h : 515] Lv1 scanning from bucket 13863 to 65536' b' [cx1.h : 528] Lv1 scanning done. Large diff: 0. Time elapsed: 0.0008' b' [cx1.h : 594] Lv1 fetching & sorting done. Time elapsed: 0.0009' b' [cx1.h : 607] Main loop done. Time elapsed: 0.0145' b' [cx1.h : 613] Postprocessing...' b' [cx1_seq2sdbg.cpp :1139] Number of $ A C G T A- C- G- T-:' b' [cx1_seq2sdbg.cpp :1142] 10 5467 3809 3793 5459 0 0 0 0' b' [cx1_seq2sdbg.cpp :1151] Total number of edges: 18538' b' [cx1_seq2sdbg.cpp :1152] Total number of ONEs: 18528' b' [cx1_seq2sdbg.cpp :1153] Total number of $v edges: 10' b' [cx1.h : 621] Postprocess done. Time elapsed: 0.0354' b' [utils.h : 126] Real: 0.2839\tuser: 0.1120\tsys: 0.1483\tmaxrss: 265500' --- [Thu Apr 29 14:29:05 2021] Assembling contigs from SdBG for k = 21 --- cmd: /gpfs/home/bbrow6/miniconda3/envs/sunbeam/bin/megahit_asm_core assemble -s /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm/tmp/k21/21 -o /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm/intermediate_contigs/k21 -t 1 --min_standalone 300.0 --prune_level 2 --merge_len 20 --merge_similar 0.95 --low_local_ratio 0.2 --min_depth 2 --bubble_level 2 --max_tip_len -1 --careful_bubble b' [assembler.cpp : 148] Loading succinct de Bruijn graph: /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm/tmp/k21/21 Done. Time elapsed: 0.063105' b' [assembler.cpp : 152] Number of Edges: 18538; K value: 21' b' [assembler.cpp : 162] Number of CPU threads: 1' b' [assembly_algorithms.cpp : 162] Removing tips with length less than 2; Accumulated tips removed: 0; time elapsed: 0.0090' b' [assembly_algorithms.cpp : 162] Removing tips with length less than 4; Accumulated tips removed: 0; time elapsed: 0.0011' b' [assembly_algorithms.cpp : 162] Removing tips with length less than 8; Accumulated tips removed: 0; time elapsed: 0.0012' b' [assembly_algorithms.cpp : 162] Removing tips with length less than 16; Accumulated tips removed: 0; time elapsed: 0.0012' b' [assembly_algorithms.cpp : 162] Removing tips with length less than 32; Accumulated tips removed: 0; time elapsed: 0.0013' b' [assembly_algorithms.cpp : 170] Removing tips with length less than 42; Accumulated tips removed: 0; time elapsed: 0.0013' b' [assembler.cpp : 179] Tips removal done! Time elapsed(sec): 0.015182' b' [assembler.cpp : 188] unitig graph size: 5, time for building: 0.008274' b' [assembler.cpp : 211] Number of bubbles removed: 0, Time elapsed(sec): 0.000091' b' [assembler.cpp : 225] Number of complex bubbles removed: 0, Time elapsed(sec): 0.000019' Error occurs when assembling contigs for k = 21, please refer to /active/jaspan_h/bryan/debugging/sunbeam_dev/test_1_042921/sunbeam_output/assembly/megahit/dummybfragilis_asm/log for detail [Exit code -11]
ideas?
Huh, that looks similar to #287. Can you try:
conda list | grep openmp_mutex
And paste in whatever it shows you?
I ran that and got nothing back so gathered that openmp_mutex wasn't install. I tried to install with
conda install _openmp_mutex
but got this error:
UnsatisfiableError: The following specifications were found to be incompatible with each other: Output in format: Requested package -> Available versions Package _libgcc_mutex conflicts for: _openmp_mutex -> _libgcc_mutex==0.1=main python=3.8 -> libgcc-ng[version='>=7.3.0'] -> _libgcc_mutex=[build=main]
Odd, it sounds like you have different packages than what I expected. Could you try updating your installed packages to exactly match our latest automated tests? There's an autogenerated package list here: https://549-57330209-gh.circle-artifacts.com/0/conda-env
So with a preexisting sunbeam env from the previous install you could do something like:
curl -L 'https://549-57330209-gh.circle-artifacts.com/0/conda-env' > pkgs_circleci.txt
conda update --name sunbeam --file pkgs_circleci.txt
tests/run_tests.bash -e sunbeam
Closing this as it should work in sunbeam3. If you encounter this again please open a new issue.
