Feature Request: Build FM index for a set of strings

[lutteropp]

Hello,

I want to use the csa_wt index for counting DNA-substrings of variable size in a file containing DNA sequencing reads. The file looks like this, i.e. the reads are separated by newline characters:

ACCGTATTTAGCACTGATCGATCGATC AAGGTCGATCGATCGATCACT AAACTACGATCGATCGTACATGCA

Is there a way to tell csa_wt that suffixes spanning a newline character should be ignored in order to speed up the lookup and further reduce the size of the FM index?

[ekg]

I also think this would be very helpful :+1: