sam parse query name too long

[sdewell]

Hi, thanks for the tool - looking forward to using it. It seems seeksv is using the full sequence as the sequence header/name in the getclip stage, and samtools is choking on this when aligning with bwa (i've tried samtools v1.5 and 1.8):

[M::mem_process_seqs] Processed 161232 reads in 3.408 CPU sec, 3.115 real sec [E::sam_parse1] query name too long [W::sam_read1] Parse error at line 235 [main_samview] truncated file.

viewing a sam file gives the same issue:

samtools view -c 14140.clip.sam [E::sam_parse1] query name too long [W::sam_read1] Parse error at line 235 [main_samview] truncated file.

example read from clip.fq.gz

@AGGCAATATAAAGATTGCTTTCAATAACCAAGAAGAATTAAACAGAATTATCAACACTCTAAAATAAGGGTGTTGATTATTTTTTTATTTAATCAAACTTATCCACAAGGTATTTTGCTATTTTTCTGTTGATTCTCTAAGCTTTTCTAATTTCCACAGTCTGTGGAAAACTTT AGGCAATATAAAGATTGCTTTCAATAACCAAGAAGAATTAAACAGAATTATCAACACTCTAAAATAAGGGTGTTGATTATTTTTTTATTTAATCAAACTTATCCACAAGGTATTTTGCTATTTTTCTGTTGATTCTCTAAGCTTTTCTAATTTCCACAGTCTGTGGAAAACTTT + +;,+CGCFCFFF<F9=6FCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG

Any suggestions? Thank you

[dpellow]

@sdewell Did you figure out how to solve this issue?