WGS-whole-region-deleted branch error
Hello,
I was attempting to use the WGS-whole-region-deleted branch of of CRISPResso2 because I have some cas12-edit nanopore amplicon reads which are 1000bp in length and have frequent 150bp deletions, which are being excluded from the master branch of CRISPResso2
I created a new conda environment, downloaded the source code, and set it up with setup.py, according to the command in build.sh.
While it builds fine, when I run CRISPRessoWGS on the same pre-made bam files / bed files / fasta files that work with the master branch of CRISPResso2, I get the following error:
Extracting reads in:FASTA:1797-1896 and creating .bam file: CRISPRessoWGS_on_barcode10/ANALYZED_REGIONS/REGION_0.bam
CRISPResso2 failed CRITICAL @ Thu, 10 Oct 2024 15:24:22
ERROR: '>=' not supported between instances of 'int' and 'NoneType'
Looking at the analyzed regions folder, it has constructed .bam and .bam.bai files of appropriate size, but the .fastq.gz files are empty, 40 bytes.
I'm wondering if I did something wrong during the installation of the branch, or if I need to make some change to my input files. master-branch CRISPResso2 that works is version 2.2.14, while the WGS-whole-region-deleted branch reports 2.2.13, so I'd expect most input files and settings to be the same.
Hi @mbosm,
Thanks for using CRISPResso! And sorry to hear that you are having trouble. I have merged the master branch into the wgs-whole-region-deleted branch, which can be found in this new branch https://github.com/edilytics/CRISPResso2/tree/wgs-whole-region-deleted-v2.3.1 Would you mind seeing if this fixes the problem?
Also, do you know if the latest release v2.3.1 still excludes the larger deletions?
Thanks, Cole
Cole, I tried the https://github.com/edilytics/CRISPResso2/tree/wgs-whole-region-deleted-v2.3.1 branch as you suggested, and it threw the same error.
I tried master-branch v2.3.1 a couple days ago and it worked fine, but did not incorporate the larger deletions.
This is from the v2.2.14, but shows the trend...
I have five potential cut sites, all near each other on the genome. One 1000bp amplicon covers all of them. The third one, target_3290, is the cas12 guide in use on this sample. Because all five sites are on the same amplicon, if all reads are being processed, there should be approximately 40,000 reads at each site. Roughly a quarter are being thrown out.
Thanks for trying the other branch, would you mind rerunning with the --debug flag and providing the output? With that I can hopefully debug where this is happening.
CRISPRessoWGS -b barcode10.bam -f C9_WT.bed -r C9_WT.fasta --default_min_aln_score 0 --debug
~~~CRISPRessoWGS~~~
-Analysis of CRISPR/Cas9 outcomes from WGS data-
_ _
' ) ' )
.-' ____________ .-'
(____ | __ __ | (____
C)| \ || |/ _ (_ | C)| \
\ / ||/\|\__)__) | \ /
\___/ |____________| \___/
[CRISPResso version 2.3.2]
[Note that as of version 2.3.0 FLASh and Trimmomatic have been replaced by fastp for read merging and trimming. Accordingly, the --flash_command and --trimmomatic_command parameters have been replaced with --fastp_command. Also, --trimmomatic_options_string has been replaced with --fastp_options_string.
Also in version 2.3.2, when running CRISPRessoPooled in mixed-mode (amplicon file and genome are provided) the default behavior will be as if the --demultiplex_only_at_amplicons parameter is provided. This change means that reads and amplicons do not need to align to the exact locations.]
[For support contact [email protected] or [email protected]]
INFO @ Thu, 10 Oct 2024 16:22:41 (0.0% done):
Creating Folder CRISPRessoWGS_on_barcode10
WARNING @ Thu, 10 Oct 2024 16:22:41 (0.0% done):
Folder CRISPRessoWGS_on_barcode10 already exists.
INFO @ Thu, 10 Oct 2024 16:22:41 (0.0% done):
Checking dependencies...
INFO @ Thu, 10 Oct 2024 16:22:41 (0.0% done):
All the required dependencies are present!
INFO @ Thu, 10 Oct 2024 16:22:41 (0.0% done):
Index file for input .bam file exists, skipping generation.
INFO @ Thu, 10 Oct 2024 16:22:41 (0.0% done):
The index for the reference fasta file is already present! Skipping generation.
INFO @ Thu, 10 Oct 2024 16:22:41 (0.0% done):
Retrieving reference sequences for amplicons and checking for sgRNAs
INFO @ Thu, 10 Oct 2024 16:22:41 (0.0% done):
Processing each region...
INFO @ Thu, 10 Oct 2024 16:22:41 (0.0% done):
Extracting reads in:C9_WT:1938-2037 and creating .bam file: CRISPRessoWGS_on_barcode10/ANALYZED_REGIONS/REGION_0.bam
Traceback (most recent call last):
File "/home/gagnonlab/miniforge3/envs/crispresso2_delFix/lib/python3.7/site-packages/CRISPResso2/CRISPRessoWGSCORE.py", line 611, in main
df_regions = CRISPRessoMultiProcessing.run_pandas_apply_parallel(df_regions, extract_reads_chunk, n_processes_for_wgs)
File "/home/gagnonlab/miniforge3/envs/crispresso2_delFix/lib/python3.7/site-packages/CRISPResso2/CRISPRessoMultiProcessing.py", line 186, in run_pandas_apply_parallel
return input_function_chunk(input_df)
File "/home/gagnonlab/miniforge3/envs/crispresso2_delFix/lib/python3.7/site-packages/CRISPResso2/CRISPRessoWGSCORE.py", line 269, in extract_reads_chunk
new_df.loc[i] = extract_reads(df.iloc[i].copy())
File "/home/gagnonlab/miniforge3/envs/crispresso2_delFix/lib/python3.7/site-packages/CRISPResso2/CRISPRessoWGSCORE.py", line 258, in extract_reads
row.n_reads=write_trimmed_fastq(row.bam_file_with_reads_in_region, row.bpstart, row.bpend, row.fastq_file_trimmed_reads_in_region)
File "/home/gagnonlab/miniforge3/envs/crispresso2_delFix/lib/python3.7/site-packages/CRISPResso2/CRISPRessoWGSCORE.py", line 225, in write_trimmed_fastq
if positions[0] <= bpstart and positions[-1] >= bpend:
TypeError: '>=' not supported between instances of 'int' and 'NoneType'
CRITICAL @ Thu, 10 Oct 2024 16:22:46 (0.0% done):
Traceback (most recent call last):
File "/home/gagnonlab/miniforge3/envs/crispresso2_delFix/lib/python3.7/site-packages/CRISPResso2/CRISPRessoWGSCORE.py", line 611, in main
df_regions = CRISPRessoMultiProcessing.run_pandas_apply_parallel(df_regions, extract_reads_chunk, n_processes_for_wgs)
File "/home/gagnonlab/miniforge3/envs/crispresso2_delFix/lib/python3.7/site-packages/CRISPResso2/CRISPRessoMultiProcessing.py", line 186, in run_pandas_apply_parallel
return input_function_chunk(input_df)
File "/home/gagnonlab/miniforge3/envs/crispresso2_delFix/lib/python3.7/site-packages/CRISPResso2/CRISPRessoWGSCORE.py", line 269, in extract_reads_chunk
new_df.loc[i] = extract_reads(df.iloc[i].copy())
File "/home/gagnonlab/miniforge3/envs/crispresso2_delFix/lib/python3.7/site-packages/CRISPResso2/CRISPRessoWGSCORE.py", line 258, in extract_reads
row.n_reads=write_trimmed_fastq(row.bam_file_with_reads_in_region, row.bpstart, row.bpend, row.fastq_file_trimmed_reads_in_region)
File "/home/gagnonlab/miniforge3/envs/crispresso2_delFix/lib/python3.7/site-packages/CRISPResso2/CRISPRessoWGSCORE.py", line 225, in write_trimmed_fastq
if positions[0] <= bpstart and positions[-1] >= bpend:
TypeError: '>=' not supported between instances of 'int' and 'NoneType'
CRITICAL @ Thu, 10 Oct 2024 16:22:46 (0.0% done):
ERROR: '>=' not supported between instances of 'int' and 'NoneType'
If it helps at all, I don't really know my way around python, but I looked at the code where it was erroring...
if positions[0] <= bpstart and positions[-1] >= bpend:
...and looked at what was being processed for my reads. Here's an example:
bpstart: 1938 bpend: 2038 positions: [None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, None, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 884, 885, 886, 887, 888, 889, 890, 892, 893, 894, 896, 897, 898, 899, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990, 991, 992, 993, 994, 995, 996, 997, 998, 999, 1000, 1001, 1002, 1003, 1004, 1005, 1006, 1007, 1008, 1009, 1010, 1011, 1012, 1013, 1014, 1015, 1016, 1017, 1018, 1019, 1020, 1021, 1022, 1023, 1024, 1025, 1026, 1027, 1028, 1029, 1030, 1031, 1032, 1033, 1034, 1035, 1036, 1037, 1038, 1039, 1040, 1041, 1042, 1043, 1044, 1045, 1046, 1047, 1048, 1049, 1050, 1051, 1052, 1053, 1054, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 1077, 1078, 1079, 1080, 1081, 1082, 1083, 1084, 1085, 1086, 1087, 1088, 1089, 1090, 1091, 1092, 1093, 1094, 1095, 1096, 1097, 1098, 1099, 1100, 1101, 1105, 1106, 1107, 1108, 1109, 1110, 1111, 1112, 1113, 1114, 1115, 1116, 1117, 1118, 1119, 1120, 1121, 1122, 1124, 1125, 1126, 1127, 1128, 1129, 1130, 1131, 1132, 1133, 1134, 1135, 1136, 1137, 1138, 1140, 1141, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1150, 1151, 1152, 1153, 1154, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1164, 1165, 1166, 1167, 1168, 1169, 1170, 1171, 1172, 1173, 1174, 1175, 1176, 1177, 1178, 1179, 1180, 1181, 1182, 1183, 1184, 1185, 1186, 1187, 1188, 1189, 1190, 1191, 1192, 1193, 1194, 1195, 1196, 1197, 1198, 1199, 1200, 1201, 1202, 1203, 1204, 1205, 1206, 1207, 1208, 1209, 1210, 1211, 1212, 1213, 1214, 1215, 1216, 1217, 1218, 1219, 1220, 1221, 1222, 1223, 1224, 1225, 1226, 1227, 1228, 1229, 1230, 1231, 1232, 1233, 1234, 1235, 1236, 1237, 1238, 1239, 1240, 1241, 1242, 1243, 1244, 1245, 1246, 1247, 1248, 1249, 1250, 1251, 1252, 1253, 1254, 1255, 1257, 1258, 1259, 1260, 1261, 1262, 1263, 1264, 1265, 1266, 1267, 1268, 1269, 1270, 1271, 1272, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1286, 1287, 1288, 1289, 1290, 1291, 1292, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1300, 1301, 1302, 1303, 1304, 1305, 1306, 1307, 1308, 1309, 1310, 1311, None, None, None, 1312, 1313, 1314, 1315, 1316, 1317, 1318, 1319, None, 1320, 1321, 1322, 1323, 1324, 1326, 1327, 1328, 1329, 1330, 1331, 1332, 1333, 1334, 1335, 1336, 1337, 1338, 1339, 1340, 1341, 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, None, 1389, 1390, 1391, 1392, 1393, 1394, 1395, 1396, 1397, 1398, 1399, 1400, 1402, 1403, 1404, 1405, 1406, 1407, 1408, 1409, 1410, 1411, 1412, 1413, 1414, 1415, 1416, 1417, 1418, 1419, 1420, 1421, 1422, 1423, 1424, 1425, 1426, 1427, 1428, 1429, 1430, 1431, 1432, 1433, 1434, 1435, 1436, 1437, 1438, 1439, 1440, 1441, 1442, 1443, 1444, 1445, 1446, 1447, 1448, 1449, 1450, 1451, 1452, 1453, 1454, 1455, 1456, 1457, 1458, 1459, 1460, 1461, 1462, 1463, 1465, 1466, 1467, 1468, 1469, 1470, 1471, 1472, 1473, 1474, 1475, 1476, None, 1477, 1478, 1479, 1480, 1481, 1482, 1483, 1484, 1485, 1486, 1487, 1488, 1489, 1490, 1491, 1492, 1493, 1494, 1495, 1496, 1497, 1498, 1499, 1500, 1501, 1502, 1503, 1504, 1505, 1506, 1507, 1508, 1509, 1510, 1511, 1512, 1513, 1514, 1515, 1516, 1517, 1518, 1519, 1520, 1521, 1522, 1523, 1524, 1525, None, None, 1526, 1527, 1528, 1529, 1530, 1531, 1532, 1533, 1534, 1535, 1536, 1537, 1538, 1539, 1540, 1541, 1542, 1543, 1544, 1545, 1546, 1547, 1548, 1549, 1550, 1551, 1552, 1553, 1554, 1555, 1556, 1557, 1558, 1559, 1560, 1561, 1562, 1563, 1564, 1565, 1566, 1567, 1568, 1569, 1570, 1571, 1572, 1573, 1574, 1575, 1576, 1577, 1578, 1579, 1580, 1581, 1582, 1583, 1584, 1585, 1586, 1587, 1588, 1589, 1590, 1591, 1592, 1593, 1594, 1597, 1598, 1599, 1600, 1601, 1602, 1603, 1604, 1605, 1606, 1607, 1608, 1609, 1610, 1611, 1612, 1613, 1614, 1615, 1616, 1617, 1618, 1619, 1620, 1621, 1622, 1623, 1624, 1625, 1626, 1627, 1628, 1629, 1630, 1631, 1632, 1633, 1634, 1635, 1636, 1637, 1638, 1639, 1640, 1641, 1642, 1643, 1644, 1645, 1646, 1647, 1648, 1649, 1650, 1651, 1652, 1653, 1654, 1655, 1656, 1657, 1658, 1659, 1660, 1661, 1662, 1663, 1664, 1665, 1666, 1667, 1668, 1669, 1670, 1671, 1672, 1673, 1674, 1675, 1676, 1677, 1678, 1679, 1680, 1681, 1682, 1683, 1684, 1685, 1686, 1687, 1688, 1689, 1690, 1691, 1692, 1693, 1694, 1695, 1696, 1697, 1698, 1699, 1700, 1701, 1702, 1703, 1704, 1705, 1706, 1707, 1708, 1709, 1710, 1711, 1712, 1713, 1714, 1715, 1716, 1717, 1718, 1719, 1720, 1721, 1722, 1723, 1724, 1725, 1726, 1727, 1728, 1729, 1730, 1731, 1732, 1733, 1734, 1735, 1736, 1737, 1738, 1739, 1740, 1741, 1742, 1743, 1744, 1745, 1746, 1747, 1748, 1749, 1750, 1751, 1752, 1753, 1754, 1755, 1756, 1757, 1758, 1759, 1760, 1761, 1762, 1763, 1764, 1765, 1766, 1767, 1768, 1769, 1770, 1771, 1772, 1773, 1774, 1775, 1776, 1777, None, 1778, 1779, 1780, 1781, 1782, 1783, 1784, 1785, 1786, 1787, 1788, 1789, 1790, 1791, 1792, 1793, 1794, 1795, 1796, 1797, 1798, 1799, 1800, 1801, 1802, 1803, 1804, 1805, 1806, 1807, 1808, 1809, 1810, 1811, 1812, 1813, 1814, 1815, 1816, 1817, 1818, 1819, 1820, 1821, 1822, 1823, 1824, 1825, 1826, 1827, 1828, 1829, 1830, 1831, 1832, 1833, 1834, 1835, 1836, 1837, 1838, 1839, 1840, 1841, 1842, 1843, 1844, 1845, 1846, 1847, 1848, 1849, 1850, 1851, 1852, 1853, 1854, 1855, 1856, 1859, 1860, 1861, 1862, 1864, 1865, 1866, 1867, None, 1868, 1869, 1870, 1871, 1872, 1873, 1874, 1875, 1876, 1877, 1878, 1879, 1880, 1881, 1882, 1883, 1884, 1885, 1886, 1887, 1888, 1889, 1890, 1891, 1892, 1893, 1894, 1895, 1896, 1897, 1898, 1899, 1900, 1901, 1902, 1903, 1904, 1905, 1906, 1907, 1908, 1909, 1910, 1911, 1912, 1913, 1914, 1915, 1916, 1917, 1918, 1919, 1920, 1921, 1922, 1923, 1924, 1925, 1926, 1927, 1928, 1929, 1930, 1931, 1932, 1933, 1934, 1935, 1936, 1937, 1938, 1939, 1940, 1941, 1942, 1943, 1944, 1945, 1946, 1947, 1948, 1949, 1950, 1951, 1952, 1953, 1954, 1955, 1956, 1957, 1958, 1959, 1960, 1961, 1962, 1963, 1964, 1965, 1966, 1967, 1971, 1972, 1973, 1974, 1975, 1976, 1977, 1978, None, None, 1979, 1980, 1981, 1982, 1983, 1984, 1985, 1986, 1987, 1988, 1989, 1990, 1991, 1992, 1993, 1994, 1995, None, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012, 2013, 2014, 2015, 2016, 2017, 2018, 2019, 2020, 2021, 2022, 2023, 2024, 2025, 2026, 2027, 2028, 2029, 2030, 2031, 2032, None, 2033, 2034, 2035, 2036, 2037, 2038, 2039, 2040, 2041, 2042, 2043, 2044, 2045, 2046, 2047, 2048, None, None, 2049, 2050, 2051, 2052, 2054, 2055, 2056, 2057, 2058, 2059, 2060, 2063, 2064, 2065, 2066, 2067, 2068, 2069, 2070, 2071, 2072, 2073, 2074, 2075, 2076, 2077, 2078, 2079, 2080, 2081, 2082, 2083, 2084, 2085, 2086, 2087, 2088, 2089, 2090, 2091, 2092, 2093, 2094, 2095, 2096, 2097, 2098, 2099, 2100, 2101, 2102, 2103, 2104, 2105, 2106, 2107, 2108, 2109, 2110, 2111, 2112, 2113, 2114, 2115, 2116, 2117, 2118, 2119, 2120, 2121, 2122, 2123, 2124, 2125, 2126, 2127, 2129, 2130, 2131, 2132, 2133, 2134, 2135, 2136, 2137, 2138, 2139, 2140, 2141, 2142, 2143, 2144, 2145, 2146, 2147, 2148, 2149, 2150, 2151, 2152, 2153, 2154, 2155, 2156, 2157, 2158, 2159, 2160, 2161, 2162, 2163, 2164, 2165, 2166, 2167, 2168, 2169, 2170, 2171, 2172, 2173, 2174, 2175, 2176, 2177, 2178, 2179, 2180, 2181, 2182, 2183, None, 2184, 2185, 2186, 2187, 2188, 2189, 2190, 2191, 2192, 2193, 2194, 2195, 2196, 2197, 2198, 2199, 2200, 2201, 2202, 2203, 2204, 2205, 2206, 2207, 2208, 2209, 2210, 2211, 2212, 2213, 2216, 2217, 2218, 2219, 2220, 2221, 2222, 2223, 2224, 2225, 2226, 2227, 2228, 2229, 2230, 2231, 2232, 2233, 2235, 2236, 2237, 2238, 2239, 2240, 2241, 2245, 2246, 2247, 2250, None, 2251, 2252, 2253, 2254, 2255, 2256, 2257, 2258, 2259, 2260, 2261, 2262, 2264, 2265, 2266, 2267, 2268, 2269, 2270, 2271, 2272, 2273, 2274, 2275, 2276, 2277, 2278, 2279, 2280, 2281, 2282, 2283, 2284, 2285, 2286, 2287, 2288, 2289, 2290, 2291, 2292, 2293, 2294, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None, None] positions[0]: None positions[-1]: None st: 1410 en: 1511
192b1e1c-e64f-4752-9518-a7bd8a65e5f5 GGATGGGGATCTGGCCTCTTCCTTGCTTTCCCCTGGGTCCCCCCGAGCTGTCTCCTTCCCCGGGGACCCGCTGGGAGCGCTGCCGCTGCGGGCTCGGGGAA
54888259CGHEEFFFG?>=;:5*)))++)+,,,(((((((()49>@@BJLEDA@>=439=3DF?A<<<:;;335-GC;;;;;?78>?=0./+0(&%%%%&
...and what it looks like is that the soft-clipping on the edges of the reads (where minimap2, the aligner I use, leaves off the barcodes and sequencing adapters) are throwing off the line, because the first and last base in the read is 'none', hence the inability to compare an integer to a non-integer.
As an experiment, I took my aligned BAM file of reads, and ran it through a utility that cuts off all the soft clipping. This allowed the program to go past this point, because the first and last array items in positions were integers.
However, it crashed again later in the run, with the following error:
CRITICAL @ Fri, 11 Oct 2024 16:42:34 (0.0% done): Traceback (most recent call last): File "/home/gagnonlab/miniforge3/envs/crispresso2_delFix/lib/python3.7/site-packages/CRISPResso2/CRISPRessoWGSCORE.py", line 620, in main df_regions.infer_objects(copy=False).fillna('NA').to_csv(report_reads_aligned_filename, sep='\t', columns = cols_to_print, index_label="Name") TypeError: infer_objects() got an unexpected keyword argument 'copy'
...which is outside my area of knowledge.
Thanks for the additional information and sorry for the delay in responding! As for the new error after you trim the soft-clipped reads, I have pushed a fix that will hopefully resolve it. Would you mind pulling the latest version from https://github.com/edilytics/CRISPResso2/tree/wgs-whole-region-deleted-v2.3.1 and see if that works?
Thanks, Cole