epa-ng icon indicating copy to clipboard operation
epa-ng copied to clipboard

Published 20 hours ago • verified publisher icon pierrebarbera

Tree Log-Likelihood -INF Error

Open kawabata-tomoko opened this issue 1 year ago • 4 comments

Hello Team, When I'm trying to place a sequence into the tree on Linux, I got en error Aborted (core dumped) without any error information. And I tried the same data and command on MacOS, core dumped again(with libc++abi: terminating with uncaught exception of type std::runtime_error: Tree Log-Likelihood -INF!). the EPA-ng version is EPA-ng v0.3.8 the command used:

epa-ng --tree refer_tree.tree --msa reference_v4.mafft --query query_aligned.fasta --model LG+F+G4 --outdir .

system infos:

Linux:     #76~20.04.1-Ubuntu SMP Mon Mar 20 15:54:19 UTC 2023 x86_64 x86_64 x86_64 GNU/Linux
MacOS:     20.6.0 Darwin Kernel Version 20.6.0: Fri Dec 16 00:35:00 PST 2022; root:xnu-7195.141.49~1/RELEASE_X86_64 x86_64

running details infos(MacOS):

% epa-ng --tree refer_tree.tree --msa reference_v4.mafft --query query_aligned.fasta --model LG+F+G4 --outdir .
INFO Selected: Output dir: ./
INFO Selected: Query file: query_aligned.fasta
INFO Selected: Tree file: refer_tree.tree
INFO Selected: Reference MSA: reference_v4.mafft
INFO Selected: Automatic switching of use of per rate scalers
INFO Selected: Preserving the root of the input tree
INFO Selected: Specified model: LG+F+G4
INFO     ______ ____   ___           _   __ ______
        / ____// __ \ /   |         / | / // ____/
       / __/  / /_/ // /| | ______ /  |/ // / __  
      / /___ / ____// ___ |/_____// /|  // /_/ /  
     /_____//_/    /_/  |_|      /_/ |_/ \____/ (v0.3.8)
WARN The reference MSA and tree have differing number of taxa! 196 vs. 186
INFO Using model parameters:
INFO    Rate heterogeneity: GAMMA (4 cats, mean),  alpha: 1 (ML),  weights&rates: (0.25,0.136954) (0.25,0.476752) (0.25,1) (0.25,2.38629) 
        Base frequencies (empirical): 0.250946 0 0 0 0.176994 0 0 0.367461 0 0 0 0 0 0 0 0 0.204599 0 0 0 
        Substitution rates (model): 0.425093 0.276818 0.395144 2.48908 0.969894 1.03855 2.06604 0.358858 0.14983 0.395337 0.536518 1.12403 0.253701 1.17765 4.72718 2.1395 0.180717 0.218959 2.54787 0.751878 0.123954 0.534551 2.80791 0.36397 0.390192 2.4266 0.126991 0.301848 6.32607 0.484133 0.052722 0.332533 0.858151 0.578987 0.593607 0.31444 0.170887 5.07615 0.528768 1.69575 0.541712 1.43765 4.50924 0.191503 0.068427 2.14508 0.371004 0.089525 0.161787 4.00836 2.00068 0.045376 0.612025 0.083688 0.062556 0.523386 5.24387 0.844926 0.927114 0.01069 0.015076 0.282959 0.025548 0.017416 0.394456 1.24028 0.42586 0.02989 0.135107 0.037967 0.084808 0.003499 0.569265 0.640543 0.320627 0.594007 0.013266 0.89368 1.10525 0.075382 2.78448 1.14348 0.670128 1.16553 1.95929 4.12859 0.267959 4.81351 0.072854 0.582457 3.23429 1.67257 0.035855 0.624294 1.22383 1.08014 0.236199 0.257336 0.210332 0.348847 0.423881 0.044265 0.069673 1.80718 0.173735 0.018811 0.419409 0.611973 0.604545 0.077852 0.120037 0.245034 0.311484 0.008705 0.044261 0.296636 0.139538 0.089586 0.196961 1.73999 0.129836 0.268491 0.054679 0.076701 0.108882 0.366317 0.697264 0.442472 0.682139 0.508851 0.990012 0.584262 0.597054 5.30683 0.119013 4.14507 0.159069 4.27361 1.11273 0.078281 0.064105 1.03374 0.11166 0.232523 10.6491 0.1375 6.31236 2.59269 0.24906 0.182287 0.302936 0.619632 0.299648 1.70274 0.656604 0.023918 0.390322 0.748683 1.13686 0.049906 0.131932 0.185202 1.79885 0.099849 0.34696 2.02037 0.696175 0.481306 1.89872 0.094464 0.361819 0.165001 2.45712 7.8039 0.654683 1.33813 0.571468 0.095131 0.089613 0.296501 6.47228 0.248862 0.400547 0.098369 0.140825 0.245841 2.18816 3.15182 0.18951 0.249313
INFO Output file: ./epa_result.jplace
libc++abi: terminating with uncaught exception of type std::runtime_error: Tree Log-Likelihood -INF!
zsh: abort      epa-ng --tree refer_tree.tree --msa reference_v4.mafft --query  --model   .

the query file(has the same length with MSA sequence after aligned with MAFFT:

>db29dfd5db5e2501ed9deadabc7dd91d
TACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGTGTAGGCGGTTTGGACAGTCAGATGTGAAATCCCCGGGCTTAACCTGGGAGCTGCATTTGATACGTCCAGACTAGAGTGTGAGAGAGGGTTGTGGAATTCTCAGTGTAGAGGTGAAATTCGTAGATATTGGGAAGAACACCGGTGGCGAAGGCGGCAACCTGGCTCATTACTGACGCTGAGGCGCGAAAGCGTGGGGAGCAAACAGG

It's seem like something wrong with my tree or query, I changed another query to place into another tree and everything is OK. the tree I used in the error situation is build by iqtree2 with command

iqtree2 -s seq/all_seq.fasta -m LG+F+G4 -pre 'tree/%s_%s' -nt 48 --fast -alrt 1000

and the tree is :

(GCF_001581085.1:0.0001883592,(((((((((((GCF_002153675.1:0.6764403004,GCF_002153735.1:0.0030645544)0:0.0000029411,GCF_002153795.1:0.0158138579)0:0.6605801847,(((((((GCF_008690765.1:0.0000000000,GCF_008690505.1:0.0000000000):0.0000000000,GCF_008690645.1:0.0000000000):0.0000000000,GCF_008690705.1:0.0000000000):0.0000000000,GCF_008690905.1:0.0000000000):0.0000000000,GCF_008690915.1:0.0000000000):0.0000000000,GCF_008704295.1:0.0000000000):0.0416326726,GCF_024158225.1:0.0053982956)0:0.0000024925)0:0.0000024344,((((((((GCF_008690365.1:0.4406791409,GCF_003323795.1:0.4617060122)0:0.1640898965,GCF_024329695.1:0.0262970073)0:0.0003373681,(((GCF_000010845.1:0.6138629501,(GCF_003391275.1:1.6768345925,GCF_014196315.1:0.0139330781)0:0.0000025327)0:0.0000021894,GCF_008704325.1:0.0375132164)0:0.0000029909,((GCF_002153605.1:0.0134270192,GCF_001499615.1:0.4663964356)0:0.0000028317,GCF_008689845.1:0.4877107087)0:0.0033911496)0:0.0000024453)0:0.0000480426,GCF_001953595.1:1.7161662788)0:0.0000026774,(((((GCF_018811985.1:1.2476321189,GCF_001580535.1:0.3701136010)0:0.0000021507,GCF_002153545.1:1.3085919649)0:0.3109927057,GCF_000010905.1:0.0137330848)0:0.0000047088,GCF_001580945.1:0.6034760600)0:0.0000022867,GCF_024158385.1:0.4899289062)0:0.0028710588)0:0.0000028918,GCF_002153745.1:1.6808551804)0:0.0001082810,(GCF_003850905.1:0.0032674677,(((GCF_003966365.1:0.0147410702,GCF_021284605.1:0.5985121941)0:0.0000028764,GCF_001580695.1:0.0350269438)0:0.0005460484,GCF_000613865.1:0.0047823241)0:0.0000164957)0:0.0232318069)0:0.0054273270,(((((((GCF_002153695.1:1.4509147497,(GCF_024158305.1:0.0514046837,(GCF_008365315.1:0.4543791870,(GCF_001642635.1:0.0922419883,GCF_001581035.1:1.6490729713)0:0.0000029322)0:0.0000027350)0:0.1683579951)0:0.0124108208,GCF_002202135.1:0.3419663450)0:0.2244853940,((((GCF_002153775.1:0.2612440122,((GCF_022130865.1:0.4022580284,GCF_024158475.1:1.3897862725)0:0.0247699162,GCF_000379545.1:0.2593021461)0:0.0000027277)100:0.3193728053,(GCF_004341595.1:0.0609295276,(GCF_003850825.1:0.0112367348,GCF_004014775.2:0.4916741059)0:0.0173493126)0:0.0007038507)0:0.0000021411,(GCF_008690725.1:0.4285462033,GCF_011516935.1:1.4206867824)0:0.1558481053)0:0.0000955949,(((((((GCF_001662905.1:0.4844812877,GCF_002005445.1:0.3366328551)0:0.0317392220,GCF_011516945.1:0.2458425154)0:0.2026757393,((GCF_022130785.1:0.0322073465,GCF_000963945.1:0.5333918479)0:0.0000022699,GCF_000193495.2:1.0022380453)0:0.0000024617)0:0.0045456014,GCF_018256985.1:0.0114794035)0:0.0000200495,GCF_024158185.1:0.7045870891)0:0.0000023903,(GCF_000285315.1:0.5450676598,GCF_008689805.1:0.1960126694)0:0.4423247183)0:0.0000948410,GCF_018811975.1:0.0090654175)0:0.0002828809)0:0.0010058575)0:0.0004283380,(((((((GCF_000963965.1:0.0060146282,((GCF_001580915.1:0.0060752079,GCF_007989335.1:0.6741506451)0:0.0000024009,(GCF_000964205.1:0.2689952602,GCF_001766235.1:0.5150130446)0:0.1617072119)0:0.0000021130)0:0.2398539718,GCF_006539325.1:0.2143134267)0:0.0203072357,GCF_001499675.1:0.5146329584)0:0.0000027795,GCF_008689865.1:0.1825394650)0:0.4026651290,GCF_024158265.1:0.0044401363)0:0.0000028173,((GCF_024158205.1:0.0042233156,GCF_011516875.1:0.5034271003)0:0.0000792547,GCF_000285275.1:1.6548804506)0:0.0000020615)0:0.0273314929,(((GCF_024158315.1:0.0070175453,(GCF_001183745.1:0.0063524715,(GCF_000787635.2:0.0065526170,GCF_002276785.1:0.4184158280)0:0.0000028871)0:0.5991026047)0:0.0000022640,(GCF_024158365.1:0.2715677289,GCF_013307325.1:1.3479024265)0:0.3013223189)0:0.0112147574,GCF_002220195.1:0.4824377378)0:0.0000023096)0:0.0000024257)0:0.0000021468,((((((GCF_007989245.1:0.0332987392,((GCF_008704245.1:0.0000000000,GCF_000755665.1:0.0000000000):0.0210429353,GCF_000963925.1:0.4718752717)0:0.0021558859)0:0.0078774398,((GCF_000241585.2:0.0088264104,GCF_021961645.1:0.6286745465)0:0.0000022309,GCF_008704305.1:0.6437612063)0:0.0002032385)0:0.0000020520,GCF_003850885.1:0.5811558117)0:0.0000020541,(((GCF_001580615.1:0.0310270635,GCF_017377745.1:0.0083640209)0:0.0000025252,((GCF_007991075.1:1.1324145009,(GCF_024158505.1:0.2977152696,GCF_003850845.1:1.2075012951)0:0.0000020645)0:0.3300841784,GCF_000755675.1:0.0192709240)0:0.0000022336)0:0.0003230373,GCF_000964225.1:0.6464079685)0:0.0000023058)0:0.0000024507,((((((GCF_000010925.1:0.6580623757,(GCF_018256865.1:0.0729211723,GCF_017377715.1:1.6458223012)0:0.0000028144)0:0.0028590724,(GCF_024158445.1:0.5296455512,GCF_024158425.1:0.1631401068)0:0.0051417052)0:0.0000023336,(GCF_001580995.1:0.0095597996,GCF_011516835.1:0.0096655497)0:0.2897252936)0:0.0000021271,GCF_018256955.1:0.1057967928)0:0.4949788116,(GCF_002173775.1:0.0033052381,GCF_014132135.1:0.0135786395)0:0.0220684424)0:0.0027175137,((GCF_008704285.1:0.5204516769,(GCF_003850945.1:0.0142766333,GCF_002554745.1:1.6439203740)0:0.0000010000)0:0.0000023521,GCF_001581075.1:1.6439085500)0:0.0018296433)0:0.0032985240)0:0.0000024196,GCF_011516735.1:0.0311539844)0:0.0007464121)0:0.0000021260,((((GCF_018256895.1:0.0238122931,GCF_002276555.1:0.3567056482)0:0.0006964877,(((((GCF_022130905.1:0.6759780445,GCF_003850805.1:0.0684026210)0:0.0031813183,(((GCF_006539345.1:0.0117079797,GCF_000429165.1:0.0027619486)0:0.4105163026,GCF_011516925.1:0.2211171337)0:0.0987070937,GCF_009914215.1:0.0889556948)0:0.0000024406)0:0.0002617895,(GCF_024158285.1:0.5527586906,GCF_011516755.1:0.0753710884)0:0.0000020481)0:0.1569666418,GCF_022130805.1:0.6070661649)0:0.1229730883,GCF_002549835.1:0.0191286796)0:0.0000027567)0:0.0000027920,(((GCF_021961685.1:0.4339536548,GCF_000963905.1:0.5731901648)0:0.1371761622,(GCF_018256915.1:0.0068522593,GCF_007991375.1:1.6104189388)0:0.0002093233)0:0.0000025380,GCF_011516865.1:0.5911367130)0:0.0002295569)0:0.0000027232,((GCF_002153475.1:0.3833738686,GCF_000613905.1:0.0057836498)0:0.0000020031,(GCF_002456135.1:0.0089582661,GCF_007989285.1:0.6700584241)0:0.0161515351)0:0.0002918145)0:0.5686823855)0:0.0000025291,(((((((GCF_007989305.1:0.1238860300,GCF_019599335.1:0.2119236220)0:0.2066203913,(((((GCF_000010825.1:0.0000000000,GCF_000010965.1:0.0000000000):0.0000000000,GCF_000010945.1:0.0000000000):0.0000000000,GCF_000010885.1:0.0000000000):0.0000000000,GCF_000010865.1:0.0000000000):0.0814400697,GCF_008689815.1:0.0319721336)0:0.0035268865)0:0.0000021231,GCF_018256975.1:0.6696643419)0:0.0000027511,((((GCF_007991395.1:0.0000000000,GCF_011516825.1:0.0000000000):0.6003152616,GCF_011516885.1:0.0099408109)0:0.0000020243,GCF_002173735.1:0.0370744835)0:0.0019782092,(((GCF_014486685.1:1.5739864716,GCF_011516655.1:0.0221378734)0:0.0000020155,(GCF_002358055.1:0.4205428001,(GCF_001581105.1:0.0591542756,(GCF_002276805.1:0.2130518592,GCF_011516765.1:1.4222825718)0:0.1270049725)0:0.0012018872)0:0.0357890234)0:0.0000120705,((GCF_008704255.1:0.6340700535,GCF_011516725.1:0.0244629949)0:0.0000029892,GCF_002153485.1:1.6164220977)0:0.0000022480)0:0.0001081203)0:0.0095606788)0:0.2193311916,(((GCF_000241625.1:0.6839073885,GCF_018256935.1:0.1832314634)0:0.0067353401,(GCF_018256835.1:0.2030163707,GCF_001581005.1:0.3323390344)0:0.0000029143)0:0.0000027006,GCF_002153575.1:1.3448122176)0:0.0000028216)0:0.3003791125,(GCF_000723785.2:0.0082027889,GCF_014218315.1:0.5230507614)0:0.0000628853)0:0.0000020699,((GCF_008689795.1:0.6260611411,GCF_002723895.1:0.2262062301)0:0.1850061244,(((GCF_018256855.1:0.6672368453,GCF_000193245.1:0.0006517461)0:0.0000026401,(GCF_002156945.1:0.4738437206,GCF_011516745.1:0.0001157176)0:0.0000024761)0:0.0483889382,GCF_002153685.1:0.0741115710)0:0.2248808694)0:0.1757701247)0:0.0000021012)0:0.0000028596)0:0.0029442856)0:0.0000026584,(GCF_024158235.1:0.0241025345,GCF_022130845.1:0.0059523180)0:0.0005193121)0:0.0000021230,GCF_001766255.1:0.5120604596)0:0.0000020516,(((GCF_017377735.1:0.0621445686,GCF_000225485.1:0.3345182353)0:0.0027563893,(GCF_024158325.1:0.6234262367,(GCF_014207635.1:0.0585282647,GCF_003850965.1:0.5727943103)0:0.0000020369)0:0.0026639284)0:0.0000024753,GCF_002153515.1:0.0780511343)0:0.5342060505)0:0.0034632152,(((GCF_019083805.1:0.0001091116,GCF_003850865.1:0.0000540390)0:0.0018101296,GCF_003850925.1:0.4782026931)0:0.0000023029,GCF_000613285.1:0.6558629151)0:0.0000025192)0:0.0000026868,GCF_024158405.1:1.0557610867)0:0.0000020045,GCF_001628715.1:0.0019204407)0:0.4800599364,GCF_002153655.1:0.1172978701)0:0.2140405767,((GCF_002006565.1:0.0894455164,GCF_009295745.1:0.0927561460)0:0.2385422753,GCF_002738225.1:0.0099295595)0:0.0000010000);

After got an error with this tree, I noticed that most nodes have zero confidence. I removed the support , still error. And I build the tree with Fasttree with fasttree -intree genus_Acetobacter.treefile ../seq/all_seq.fasta> fast.tre (transform it to binary tree with ete3:tree.resolve_polytomy()), still error. What can I do to solve this problem? Looking forwards to your reply. Thanks a lot.

the MSA file is uploaded as attachment. max_16s_ref.txt

kawabata-tomoko avatar May 09 '23 13:05 kawabata-tomoko