finding pseudoalignments for the reads ...Segmentation fault (core dumped)

[aungthurhahein]

When trying to get pesudobam file, it gives me the core-dump error. Machine is Ubuntu server with x86-64 architecture.

kallisto quant -i Trinity.fasta.kallisto_idx -l 590 -s 160.95 -o out --pseudobam --single ge50.fasta > out.sam

[pmelsted]

What is the error reported? We fixed an issue in v0.42.5 which could be the cause of this. Can you run this on the latest versio 0.42.5

[aungthurhahein]

Kallisto version is 0.42.4 and this is the error message:

finding pseudoalignments for the reads ...Segmentation fault (core dumped) 

I will download v0.42.5 and try again. I will get back to you with the outcome.

[aungthurhahein]

I tried with kallisto ver. 0.42.5 with the following command and the error still persists.

Command:

kallisto quant -l 605 -s 136 -i Trinity.fasta.kallisto_idx -o aln_out --pseudobam --single lib.fasta

Program halted with the following error:

@SQ     SN:c10356_g10356_i1     LN:1195
@PG     ID:kallisto     PN:kallisto     VN:0.42.5
Segmentation fault (core dumped)

[pmelsted]

In your case you seem to have only a single sequence in your index, can you confirm that this is what you expected?

Can you run kallisto quant without the pseudobam, I'm just trying to isolate whether there is a problem with the pseudobam or other parts.

can you also report what is written to stderr when you run your command as kallisto quant -l 605 -s 136 -i Trinity.fasta.kallisto_idx -o aln_out --pseudobam --single lib.fasta > lib.sam

[aungthurhahein]

The index file has more than one sequence. I just reported the end of the stdout.
I can run kallisto quant without generating pseudobam successfully.

This is the output of both stdout and stderr:

[quant] fragment length distribution is truncated gaussian with mean = 605, sd = 136
[index] k-mer length: 31
[index] number of targets: 10,357
[index] number of k-mers: 5,947,007
[index] number of equivalence classes: 24,998
[quant] running in single-end mode
[quant] will process file 1: /colossus/home/anuphap/EST/EST_lib_IDs/pm/slect_bytissues_pm_chula/PM82_wTempLibID_04092014.txt.PmTwI.seqID.fasta
[quant] finding pseudoalignments for the reads ...@HD   VN:1.0
@SQ     SN:c0_g0_i1     LN:216
@SQ     SN:c1_g1_i1     LN:374
@SQ     SN:c2_g2_i1     LN:197
...
@SQ     SN:c10354_g10354_i1     LN:594
@SQ     SN:c10355_g10355_i1     LN:682
@SQ     SN:c10356_g10356_i1     LN:1195
@PG     ID:kallisto     PN:kallisto     VN:0.42.5
Segmentation fault (core dumped)

Also, "core.xxxx" file is written inside the working directory.

[pmelsted]

The sequences you are aligning have the ending .fasta are they truly FASTA entries and not FASTQ. Because pseudoalignment outputs SAM files which are required to have a quality string kallisto (probably) fails because it has no quality string.

I'll have to check for this a bit more carefully when doing pseudoalignment.

kallisto never uses the quality values so you can supply a dummy value, essentially converting the FASTA file to a FASTQ files.

You can try this by just converting the first few sequences of the input file to FASTQ

[aungthurhahein]

Yes.I confirmed that .fasta file has no quality file. I didn't mention it before because don't expect that it can be the cause of the issue.

I will test with .fastq file format and report the outcome soon.

[maubarsom]

I also ran into a segfault when generating the pseudobam, but due to a slightly different problem . I was running kallisto using process substitution to deal with an interleaved paired end file e.g

kallisto quant -t 8 -i kallisto.idx -o my_sample --pseudobam <(seqtk seq -1 interleaved.fq) <(seqtk seq -2 interleaved.fq)

Kallisto runs perfectly fine without the --pseudobam flag, but it crashes if I request the pseudobam.

I figured the pseudobam needs re-reading the fastq files, so I tried doing the split beforehand and then the seg fault does not happen (runs fine).

Would be nice to add this to the docs at least :). A nice would have also would be support for interleaved paired end files :)

[Evi-050]

Hello, I face this problem: " [ bam] writing pseudoalignments to BAM format .. Segmentation fault" and I have no idea how to fix it. I have smartseq.2 single reads, dual indexed ( this is who the fastq reads look like: @NB551291:160:H55CJBGXF:1:11101:12947:14932 1:N:0:TAAGGCGA+GCGATCTA GGCGTGTCCCGCGCGTGTGGGGGGAACCTCCGCGTCGGTGTTCCCCCGCCGGGTCCGCCCCCCGGGCCGCGGTTTT + AAAA/EAAAEEEA/EEAEEEAEE/E/EEEEEEAEA/EEEEEEEEEEEEEAEEEE/E/EAEEAEEE6AE/</EA/// )

I run this pipeline: [user@vm-129-49 mouse1.fastq_gz]$ kallisto quant -i /ad/vlachou/scRNAseq.2/kallisto_analysis/gencode.vM24.transcripts.idx --output-dir /ad/vlachou/scRNAseq.2/kallisto_analysis/kallisto_quant/gencode_indexed/mouse1 --pseudobam --genomebam --gtf /vlachou/scRNAseq.2/kallisto_analysis/gencode.vM24.annotation.gtf.gz --single -l 530 -s 150 -t 16 *fastq.gz

this is the outcome message: [quant] fragment length distribution is truncated gaussian with mean = 530, sd = 150 [index] k-mer length: 31 [index] number of targets: 142,552 [index] number of k-mers: 120,672,054

[quant] finding pseudoalignments for the reads ... done [quant] processed 482,819,438 reads, 208,880,499 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,273 rounds [ bam] writing pseudoalignments to BAM format .. Segmentation fault I tried the same with esnembl as reference but I get the same problem.

If anyone could help me out, it would be great! Thanks

[kopardev]

Any idea if this issue has been resolved yet. I am also getting something very similar:

[  bam] writing pseudoalignments to BAM format .. /spin1/swarm/kopardevn/M0tDGHNewa/cmd.10: line 1: 12564 Segmentation fault      ( kallisto quant -i mm10_M21 -o TreatmentB_S72 --bias --plaintext
--fusion --rf-stranded -t 56 --pseudobam --genomebam --gtf genes.gtf -c mm10.genome trim/TreatmentB_S72.R1.trim.fastq.gz trim/TreatmentB_S72.R2.trim.fastq.gz )

[Evi-050]

So, personally, I went with STAR since I was not in a hurry, but someone in another post suggested going back to the older version that works. But frankly, I didn't try it. Also if I remember when I removed the "--pseudobam --genomebam --gtf genes.gtf" and run for example "kallisto quant -i index -o output --single -l 200 -s 20 file1.fastq.gz file2.fastq.gz file3.fastq.gz" it worked.

Very good luck!

[redst4r]

keeps happening to me too in kallisto 0.46.2:

[quant] finding pseudoalignments for the reads ...

[quant] done
[quant] processed 250,960,675 reads, 156,761,018 reads pseudoaligned
[   em] quantifying the abundances ... done
[   em] the Expectation-Maximization algorithm ran for 1,513 rounds
[  bam] writing pseudoalignments to BAM format .. [1]    2673 segmentation fault

works when removing the --genomebam flag, but I'd really like to get the bamfile out of this