Question about MITEs

[tongyin121]

Hello, during the use of EDTA, I found that many MITE transposons are enriched in certain regions of the genome and belong to the same TE family (TE_00001032#MITE/DTM). The sequence is TTGCCTTTGAATTTCGGGTGATCTCTCTTGAGCATGTATGCTTCTGCTACTTGTTCTACATCAGACTTCTTCCGCAAACGGCGAAACGCTTTGACTCGGTGAGTTTCGCGGCATTCCGACTTCGATGCCCCAAATTACC. I would like to ask how to verify the validity and accuracy of the annotation results?