gtool
gtool copied to clipboard
Small utility to quickly find size and GC content of a fasta file. Can also extract sequence. Who doesn't like QUICK and DIRTY!
Introduction
When doing bioinformatics/genomics you always manipulate fasta files (at least I do) and often you need the size/GC content of your genomes as a quick check. Or after a blast you have the coordinates of a match and you want to extract the sequence for future analysis. This why I wrote this small script.
The script should be very fast, each fasta file is read only once and nothing is stored in memory (except the extracted contig).
Deps
- Python 3
Usage
The script takes a file, list of files or can read from stdin using - as input.
$ ./gtool.py --help
usage: gtool.py [-h] [-s] [-g] [-c CONTIG] [-e start stop] seqIn [seqIn ...]
positional arguments:
seqIn Genome, list of genome or stdin (uses '-' for stdin)
optional arguments:
-h, --help show this help message and exit
-s, --size Show size.
-g, --gcontent Show GC content.
-c CONTIG, --contig CONTIG
Specify contig to work on, supports regular
expressions.
-e start stop, --extract start stop
Extract sequence from START to STOP, works only with
-c and stops at the first match.
Examples
I've provided two fasta files to work on.
Show size
$ ./gtool.py -s A.fasta
SeqName: A
Contig: 3
Size: 924
Show size and GC content of all fasta files
$ ./gtool.py -sg *.fasta
SeqName: A
Contig: 3
Size: 924
GC%: 48.16
SeqName: B
Contig: 2
Size: 1302
GC%: 47.31
Show size and GC content of contig2, read from stdin
$ cat A.fasta | ./gtool.py -sg -c contig2 -
SeqName: stdin
Contig: contig2
Size: 252
GC%: 53.97
Extract sequence from 10 to 35 on contig1, with and without output
$ ./gtool.py -sg -c contig1 -e 10 35 B.fasta
SeqName: B
Contig: contig1 Some prot
Size: 26
GC%: 57.69
Seq: GTATCGGGTAGGTGACTGCGACGAGA
$ ./gtool.py -c contig1 -e 10 35 B.fasta
>contig1 Some prot
GTATCGGGTAGGTGACTGCGACGAGA
Stupidly complicated
$ blastn -subject A.fasta -query B.fasta -outfmt 6 -evalue 1e-10 -culling_limit 1 \
| awk '{print "-c "$1" -e "$7" "$8'} \
| xargs -n5 ./gtool.py B.fasta
>contig2 rubadub
TATTTTCGTCAATTAATGAACTAATCATATTATTCATTAAATGCGTTTTCCCAACACCATTCCGACCAATTAGCACATGAATATTTGTTGGGGGATTGCTCTCTGGTATCACTTCAAAACTTAACTTAATACGGTCAGAGTCAGTGCCTTTCATCACTGGTGAGTTATATGAAAATGAATATTTTGAAAGTCGAGCACCTCCGTTCGCAAGTCGACGAAACTGTCCCTTAATAGATGTATGGCTGACGGATCTCAGAAGAGATATGCTAGTGACCCTCTCATTTATTGCTTTAT
Support
Open a issue :)