amptk
amptk copied to clipboard
usearch9 not found when generate UTAX database
When I tried to build custom COI database,I got this error in step #generate UTAX database ##########this is my code amptk database -i arth10000.BIN-consensus.fasta -f LCO1490 -r GGWACTAATCAATTTCCAAATCC --primer_required rev \
--derep_fulllength --format off --subsample 00000 --primer_mismatch 4 -o COI02_UTAX --min_len 200 \ --create_db utax --install --source NCBI
[05:14:28 PM]: OS: Ubuntu 20.04, 8 cores, ~ 17 GB RAM. Python: 3.10.13
[05:14:28 PM]: AMPtk v1.6.0, VSEARCH v2.25.0
[05:14:28 PM]: Base name set to: /home/tanyihua/miniconda3/envs/amptk/lib/python3.10/site-packages/amptk/DB/COI02_UTAX
[05:14:28 PM]: Searching for primers, this may take awhile: Fwd: GGTCAACAAATCATAAAGATATTGG Rev: GGATTTGGAAATTGATTAGTWCC
[05:14:28 PM]: 6,067 records loaded
[05:14:28 PM]: Using 8 cpus to process data
[05:14:29 PM]: 1 records passed (0.02%)
[05:14:29 PM]: Errors: 0 no taxonomy info, 0 no ID, 5,777 length out of range, 0 too many ambiguous bases, 289 no primers found
[05:14:29 PM]: Now dereplicating sequences (collapsing identical sequences)
[05:14:29 PM]: 1 records passed (0.02%)
[05:14:29 PM]: Creating UTAX Database, this may take awhile
Traceback (most recent call last):
File "/home/tanyihua/miniconda3/envs/amptk/bin/amptk", line 10, in