NOVOPlasty
NOVOPlasty copied to clipboard
Does NovoPlasty support reads obtained from the DNBseq sequencing platform?
Hi.
I am thinking about obtaining my next sequences through DNBseq (https://en.mgi-tech.com/products/instruments_info/5/) instead Illumina. As far as I can see in the NovoPlasty configuration files, the program supports reads from ion Torrent and Illumina. Any chance the program might accept reads from this other sequencing platform?
Thanks! Best regards,
Fernando.
Hi,
No idea, never heard of it. If you give some more information I could see if possible
Are they short reads, and all the exact same length?
What is the accuracy, similar like illumina?
Are there indel errors? With Illumina it are only substitution errors, except in SNR
Are reads paired or single end?
Greets
Hi.
Thanks a lot for your answer.
This is what the person from the company answered to your questions:
Our FASTQ output form as below show :
@Instrument ID:1:FCX:1:15:6329:1045 1:N:0:ATCCGA TCGCACTCAACGCCCTGCATATGACAAGACAGAATC
<>;##=><9=AAAAAAAAAA9#:<#<;<<<????#=
The first and third lines are sequences names generated by the sequence analyzer; the second line is sequence; the fourth line is sequencing quality value, in which each letter corresponds to the base in line 2; the base quality is equal to ASCII value of the character in line 4 minus 33, e.g. the ASCII value of C is 67, then its base quality value is 34.
What’s the NovoPlasty required input format , it may have different requirement , and most different is the header , you can need change the ID , I think is fine, the following base sequence do not be effected .
Are they short reads, and all the exact same length? -Yes.
What is the accuracy, similar like illumina? -DNBSEQ data accuracy is highly consistent with Illumina platforms (demo WGS data available)
Are there indel errors? With Illumina it are only substitution errors, except in SNR -DNBSEQ has the similar 3’-O-Block Reversible terminator technology with Illumina, which can avoid the Indel error caused by continuous read of same bases.
Are reads paired or single end? -It depends. Most our product is delivered by pair-end.
Best wishes,
Fernando.
yeah it should work fine then, just use illumina as setting... If there is a problem, you can contact me