rna-tools
rna-tools copied to clipboard
🔧rna-tools: a toolbox to analyze sequences, structures and simulations of RNA (and more) used by RNA CASP, RNA PUZZLES, and me ;-) docs @ http://rna-tools.rtfd.io web @ http://rna-tools.online
``` (base) ➜ R1117 git:(master) ✗ rna_pdb_tools.py --get-seq R1117TS470_4.pdb # R1117TS470_4 >0:1-30 UUGGGUUCCCUCACCCCAAUCAUAAAAAGG ```
``` (base) ➜ endo rna_pdb_tools.py --extract A:1-25+B:30-57 1jj2.pdb | head REMARK 250 Model edited with rna-tools REMARK 250 ver 3.13.8+3.g841dfbbe.dirty REMARK 250 https://github.com/mmagnus/rna-tools REMARK 250 Thu Sep 28 19:45:32 2023...
``` (base) ➜ endo wget https://files.rcsb.org/download/1jj2.cif --2023-09-28 19:54:13-- https://files.rcsb.org/download/1jj2.cif Resolving files.rcsb.org (files.rcsb.org)... 128.6.159.157, 128.6.159.100, 132.249.213.241, ... Connecting to files.rcsb.org (files.rcsb.org)|128.6.159.157|:443... connected. HTTP request sent, awaiting response... 200 OK Length: unspecified...
``` 2 of chains: A 1 of RNA chains: A wrong atom order in residue of chain A resid 1 P O5' wrong atom order in residue of chain A...
``` rh:~$ rna_pdb_tools.py --cif2pdb 4v6x.cif Warning: some of the chains in this mmCIF file has chain names with more char than 1, e.g. AB, and the PDB format needs single-letter...