Is it possible to add the name of each record in fasta to the output file?

[Meng0625]

Hi,

I want to know is there any option able to add each cdr3's original name in the fasta to the final output?

I mean if the name of the original sequence in fasta like:

TRINITY_DN0_c0_g1_i3 GGTCCAGTGAATGCTGGTGTCACTCAGACCCCAAAATTCCGCATCCTGAAGATAGGACAG AGCATGACACTGCAGTGTACCCAGGATATGAACCATAACTACATGTACTGGTATCGACAA...

And its relevant output in the output file would get a column of its original record name: 1.0 1 TRBV6-201 . TRBJ2-101 TGTGCCAGCAGTTATGATTGGGAGCAGTTCTTC CASSYDWEQFF .... TRINITY_DN0_c0_g1_i3

Many thanks