Stop Codons Outputting as "?"

[majorkazer]

Hi Mike,

It seems that when an alignment has a stop codon in the cdr3, the amino acid output contains a "?"

In my particular case I see something like what I've attached where the NT sequence is: TGTGCTCTGAGTGAGGATGAAACTGGGGCAAACAACCTTTCTTT and the AA sequence reported is: CALSEDEa?cWGKQPFF

It seems like this was once an issue in BLAST: http://blastedbio.blogspot.com/2012/08/stop-breaking-ncbi-blast-searches.html.

Thanks, Sam

2014-IV9-TCR-E10_S58_L001_aligned.txt