TwoPaCo
TwoPaCo copied to clipboard
medvedevgroup
A fast constructor of the compressed de Bruijn graph from many genomes
1) Add error checking after the first pass 2) Add try/catch around checking constructing the parser (checking if file exists)
Hi, Thank you for developing TwoPaCo! I had the following error when I compiled the files. I know this should be related to the **TBB library**, which I followed the...
TwoPaCo is used by [Pufferfish](https://github.com/COMBINE-lab/pufferfish) which currently embeds a patched code copy of TwoPaCo. Patches seem to transform `main()` function to make it callable in C/C++ code circumventing the command...
Hey @iminkin! I'm trying to run this on another dataset however I keep getting the "[the input is corrupted](https://github.com/medvedevgroup/TwoPaCo/blob/2c46b3073b89124063c7619b3587482ef945b5f8/src/graphdump/graphdump.cpp#L471)" error. I tried to take a look at the source code...
We just run `twopaco` for thousands of bacterial genomes and now it's at: ``` Round 0, 0:4398046511104 Pass Filling Filtering ``` However, when we look at `top` we see that...
Let's use this very simple FASTA: ``` >seq1 ATATGTCGCTGATCGACTGAAATAGCATCGACTAGCTATCGAT >seq2 ATATGTCGCTGATCGACTGAATAGTGAAATAGCATCGACTAGC >seq3 ATATGTCGCTGATCGACTTTTTTTTGAAATAGCATCGACTAGC ``` Then we construct the graph: `./twopaco -k 15 -f 16 test.fa -o graph` and convert it...
Does `TwoPaCo` stand for "Two Path Compaction"? This is for a paper where we're trying to provide full names for acronyms and compressed program names to make the jargon less...
Hello, I am writing because it seems like there is a typo in the main README under the graphdump / GFA section. Seems like `graphdummp` should be `graphdump` Best, Domenick
Dear @ilyaminkin and @pashadag , I'm Fatemeh, @rob-p's student. This pull request is regarding the conversation we had about outputting a cdbg with segments having overlap of k-1 instead of...
Hitting a general issue with install, despite following the directions. As a friendly reminder, if developers expect (moderately) computationally literate biologists to use their software, they need to provide explicit...
Metadata
Owner
Metadata
A fast constructor of the compressed de Bruijn graph from many genomes