Joshua Timmons comments

Results 34 comments of


                                            Joshua Timmons

Fix `testing-library/react` weirdness: `act(...)` and async render

@mattwongasimov I'm not 100% certain that it's fixed but I tried to fix it in this release: https://github.com/Lattice-Automation/seqviz/releases/tag/3.7.9 The change is to parse sequences and files synchronously (in the constructor),...

Fix `testing-library/react` weirdness: `act(...)` and async render

This is the main reference @mattwongasimov, have to grab elements by their test ID and concatenate their sequences: ```js const props = { name: "test_part", seq: "ATGGTAGTTAGATAGGGATACCGATAGACTTGAGAGATACCGCATCTATTTACGACCAGCGAGCAG", testSize: { height:...

Add team name update modal

@ConorMaley I'm 100% open to contributions, and thank you! I'll check it out as soon as I get some time

inf values returned from dg() on RNA sequences

Hey @ijhoskins, thanks for reporting this! I just pushed a fix. This was because of an unfortunate bug seen when the outermost structure is a multibranch. I pushed a fix...