Mykrobe-predictor
Mykrobe-predictor copied to clipboard
Probeset Documentation
Hi First of all I want to thank you for this amazing piece of software. I am using it widely with S. aureus, and results are to be published soon. While documenting the results, I bumped into the issue of a lack in documentation of the probe sequences included in the updated panel "staph-amr-probe_set_v0_3_13-160715.fasta". Is there a Documentation of the updated sequence collection available somewhere? There has been quiet some changes since the 2015 publication, so the documentation there only helps partially.
Thanks a lot in advance!
By the way: there seems to be an issue with the latest version of the panel at line 2054, where a sequence is truncated with the name of the following sequence:
2053 CGTGAATATCGTGTTCTTTTCACTAAAAACCAATTCCGACAGGCTTTGAAGCATGCAAAT
2054 GTCACTAAersion=5
2055 ATGAACCAGAAAAACCCTAAAGACACGCAAAATTTTATTACTTCTAAAAAGCATGTAAAA
Wow - thanks for spotting this. I've just used the tip of master without seeing any problem, how on earth is that possible!? Is this for TB or Staph?
This is staph
Ah sorry, I read the final comment without reading the main Issue Report, my apologies. You're right about the probeset documentation, we need to set things up so people can see online what the current catalog is.
No matter. And yes, that would be awesome. Do you have any idea how soon this could happen? Once online, it could potentially even be extended by the community (with sufficient evidence of course), which could help spotting new markers easily. But that just an idea for the future...
That is precisely the idea for the future :-) I need to talk to @Phelimb about timings; we have a lot on so not super-rapidly, but it would be good for us to have a list of things that are on our roadmap.
Great 👍 So here is a potentially small and a slightly bigger point for the list. I was interested in the references for the four tet(K)-sequences in the panel. Is there a possibility you coul help me out with these in the meantime?
Do you mean - you want to know where the 4 tet(K) sequences are from? Or what was our decision process on including them?
I need to reference to them - so only where they are from.