somaticseq
somaticseq copied to clipboard
An ensemble approach to accurately detect somatic mutations using SomaticSeq
I downloaded high-confidence_sINDEL_in_HC_regions_v1.2.vcf.gz and high-confidence_sINDEL_in_HC_regions_v1.2.vcf.gz from FTP but noticed that some of the variants are not in the regions defined by High-Confidence_Regions_v1.2.bed. This led to issues when I compared my...
I am trying to use "BamSurgeon" which uses SomaticSeq, however there is an error that reaches that step: docker run --rm -v /home/data:/home/data -u ####:#### lethalfang/somaticseq:latest \ java ... "Error...
I'm trying to run somaticseq_parallel on some samples VCFs to call the AI consensus. The version for SomaticSeq is SomaticSeq v3.7.3. Version of XGBOOST is 2.0.2 I've run all mutation...
Hi, We use somaticseq to just merge variants from Mutect2 and HMF Tools SAGE (the latter as "arbitrary" vcf's), the classification module is not used currently. However we were missing...
Hi @litaifang, Thanks for your great tool which helps me a lot. I wonder if there is an option/parameter to output the vcf file which contains not only the allele...
Hello, I am trying to run SomaticSeq on RNA data (single-end reads) but it's really slow. It never finished because I had to kill it after 7 days. I have...
Hi, is it possible that the snakemake implementation supports single "tumour-only" samples? It looks as though it doesn't, or at least this usage is not described. I am making a...
when I run somaticseq "--run-mutect2 --run-vardict --run-lofreq --run-scalpel --run-strelka2 --run-somaticseq --run-workflow ", I found some indels had frequency of zero. For example, chr1 156842000 . A AAGAAAACTGATGTAAAGTAG 0.0 REJECT MDLPK=1,0,0,0,0;NUM_TOOLS=1;LC=11.5;AF=0...
This PR adds onboarding documents with Mermaid diagrams that provide a high-level overview of the SomaticSeq codebase. You can see an example of how these diagrams render in another project...
Hi, I generated training classifiers using the SEQ2 data and am trying to classify my data with the trained classifiers. I am working with multiple tumor-normal pairs, and some have...