CodonAdaptationIndex
CodonAdaptationIndex copied to clipboard
Benjamin-Lee
Python Implementation of Codon Adaption Index
I think it is the 2to3 option in setup.py. Is 2to3 still needed? `Collecting CAI Using cached CAI-1.0.3.tar.gz (6.0 kB) ERROR: Command errored out with exit status 1: command: /home/bjorn/anaconda3/envs/new39/bin/python3.9...
I made a conda package of version v1.0.3, available [here](https://anaconda.org/BjornFJohansson/cai). Install by: `conda install -c bjornfjohansson cai`
Hi, I made a notebook confirming that CAI gives the expected results from the old data in the original papers. [gist](https://gist.github.com/BjornFJohansson/2ad36af44695f6fc09679b3484c5f47d) Perhaps you would consider including it? Is so, I...
Welcome to [Renovate](https://togithub.com/renovatebot/renovate)! This is an onboarding PR to help you understand and configure settings before regular Pull Requests begin. :vertical_traffic_light: To activate Renovate, merge this Pull Request. To disable...
![renovate[bot] avatar](https://avatars.githubusercontent.com/in/2740?v=4 "renovate[bot] avatar"){kind=avatar}
I am checking RSCU() method and it seems to me that small performance improvement is possible in codon counting. It should be faster to once call upper() method for a...
Just like it sounds. It'd be great to see how to use the RSCU param in the docs. In particular how to integrate it with the value from `python_codon_tables.get_codons_table()`. Most...
I am testing CAI package following your instructions and I got a bug when processing small sequences. My sequence is: ``` >testseq ATGAAATTAATATTGAAACTCGTGGAACGGAAAAAACTGATCAAGGAGTTAAAAGAAGATATTGAAGTAATTTAA ``` Then, when I execute the program:...
Hello, I took inspiration from your CAI functions to: - create a separate Count3mers function to count - simplify the RSCU function to call Count3mers - added CodonFrequencyByAA function to...
The old `intersphinx_mapping` format has been removed; it must now map identifiers to (target, inventory) tuples.
