Egor Dolzhenko

Hi Heather, We will definitely release this script as soon as we have the first working version. Meanwhile perhaps you could consider using the script referenced in [this issue](https://github.com/Illumina/ExpansionHunterDenovo/issues/39)? Best...

Thank you for the question. The program can be sensitive to the accuracy of repeat coordinates. This is especially true when the sequence surrounding the repeat is very similar to...

Thanks for providing an example. In this case, the repeat definition from EH catalog is the better one to use. Note that the region 18:53253386-53253458 corresponds to sequence CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG which...

Also, very good point about the additional repeat! We will investigate if incorporating this repeat into the catalog improves accuracy. (FYI @yjqiu, this satellite repeat might be relevant for your...

Yes, modifying reference coordinates of a repeat would result in less accurate, lower scoring alignments. To assist with this better, would you be able to generate visualizations for modified and...

This sounds good!

Apologies about this issue. Could you please confirm that the reference you are using is the same as the one used to generate the CRAM file? (All contig names in...

Hi Volkan. Thanks for raising the issue. Could you please check if changing the variant type from "Repeat" to "RareRepeat" resolves the issue?

Great question, Volkan. The off target regions are only allowed for "RareRepeat"s (EH uses in-repeat read pairs only for "RareRepeats" and common locations where these reads misalign correspond to off...

This sounds good! I think it might be better to not define off target regions for most/all repeats in your catalog (and so set variant types of all repeats to...