Scores are not calculated for multi-fasta input by `score-msa` subcommand

[mt1022]

Hi, dear developer,

I want to score a single alignment with phylocsf++ as shown below. However, the output file only contains headers and scores were not calculated. Is there something wrong with my input file?

cat test.fa
# >hg38
# ATGTGCAAATTTCCCGGGACGTGACGAATGCAGCTGGTAAGGATCATACAA---AAG
# >mm39
# ATGTCCAAATTTCCCGGGACGTGACGAATGCAGCTGGTAAGGATCATACAAGGGAAG
# >rn6
# ATGTCCAAATTTCCCGGGACGTGACGAATGCAGCTGGTAAGGATCATACTAGCGAAG

phylocsf++ score-msa --threads 1 100vertebrates test.fa
# Done!

cat test.fa.scores 
# # PhyloCSF scores computed with PhyloCSF++ v1.2.0 (9643238d, 2022-01-04)
# seq	start	end	strand	phylocsf-score	bls-score

Thanks for your help!