Christophe Klopp

Results 31 comments of Christophe Klopp

Exactly. For each kmer I would like all the chr/positions at which it is located in the genome.

Thank you, I will try this.

I succeeded installing and indexing the genome with pufferfish but when I launched kquery I got : There is no command "kquery" The valid commands to pufferfish are : {align,...

Thank you Rayan, When i try to use a bcalm data base build with 47mers (input fasta file) using -kmer-size 47 parameter then for each of my reads I only...

Hi Camille, Thank you. It has fished and produced a non empty .unitigs.fa file which I have given to the Reindeer index with the -f option using -k 21. It...

Hi Camille, Here are my command line and some data about my file Firs command line bcalm -in d4260e1d07c24dd88bea.double.dump.fasta -kmer-size 21 -abundance-min 1 head d4260e1d07c24dd88bea.double.dump.fasta >1 AAAAAAAAAATATAGACCATT >2 AAAAAAAAAATATTCCCCGTT >3...

I forgot this, thank you. But this does not change the result echo "$PWD/d4260e1d07c24dd88bea.double.dump.unitigs.fa" > fof.txt Reindeer --index -k 21 -f fof.txt -o with.double.dump.unitigs ############# REINDEER version v1.0.2 ############# ......

head d4260e1d07c24dd88bea.double.dump.unitigs.fa >0 LN:i:21 KC:i:1 km:f:1.0 AAAAAAAACGTCCAAAATCAA >1 LN:i:21 KC:i:1 km:f:1.0 AAAAAAAACGTCTGGGCTGCA >2 LN:i:22 KC:i:2 km:f:1.0 TTTTTGAACTAAAAAACGTCAA >3 LN:i:21 KC:i:1 km:f:1.0 AAAAAAACGTCAGCAGGACCC >4 LN:i:21 KC:i:1 km:f:1.0 AAAAAAACGTCGGCCAGGAAC

Works for me too! Reindeer -f fof.txt --index -k 21 ############# REINDEER version v1.0.2 ############# Command line was: Reindeer -f fof.txt --index -k 21 Indexing k-mers... ... ----------------------INDEX RECAP---------------------------- Kmer...

I've tested with 200000, 2000000 lines and the complete file and it worked??!! Thank you