ShortStack icon indicating copy to clipboard operation
ShortStack copied to clipboard

Published 20 hours ago • verified publisher icon MikeAxtell

Double tab in Counts.txt

Open juancresc opened this issue 6 years ago • 2 comments

Hi!

I've noticed in the Counts.txt, unplaced sRNA have double tab between the main and first condition column.

UUUUAUUAUGAUCCAUUUCGCGUGGAAUUCUGGGUGCCAAGGAACUCCAG NA 114 37 15 37 25 In this case, between 114 and 37. What I had to do to solve this was:

tr -s '\t' '\t' < counts.csv > counts.fixed.csv

This could lead to some issues when doing downstream analysis.

Regards!

juancresc avatar Feb 13 '19 17:02 juancresc

Thanks for leaving an easy solution! I was also having troubles with it

acontrerasg avatar Aug 26 '19 09:08 acontrerasg

Yikes. I will make sure this gets fixed in the next major release. Actually I think reporting the unplaced sRNAs in the same file as the locus counts was poor decision in the first place, and I intend to separate them in the next major release.

MikeAxtell avatar Nov 03 '20 14:11 MikeAxtell

A new major update to ShortStack, version 4.0, is now in alpha testing: It is available on the ShortStack4 branch. Once we complete alpha testing this will be merged to master and released. But for now you are welcome to test it out. This glitch in the Counts.txt file has been fixed .. the unplaced sRNAs have been removed altogether.

MikeAxtell avatar Jan 21 '23 14:01 MikeAxtell