MaestSi
concatenateFastq process wouldn't recognize fastq.gz file in the working directory
I tried to run the pipeline (https://github.com/MaestSi/MetONTIIME.git) using the following command:
nextflow -c test.conf run $INSTALL_DIR/MetONTIIME/metontiime2.nf -profile singularity
where in the test.conf I changed the following parameters to be my own, others are all kept as is in the pipeline's metontiime2.conf:
workDir="/share/pkg.8/metontiime/2.1.0/test"
dbSequencesFasta="16S.fasta
singularity.cacheDir = ".singularity/cacheDir"
resultsDir="/share/pkg.8/metontiime/2.1.0/test/test_result"
and I got the following error which puzzled me:
ERROR ~ Error executing process > 'concatenateFastq'
Caused by:
Process `concatenateFastq` terminated with an error exit status (1)
Command executed:
mkdir -p /share/pkg.8/metontiime/2.1.0/test/test_result
mkdir -p /share/pkg.8/metontiime/2.1.0/test/test_result/concatenateFastq
cp /share/pkg.8/metontiime/2.1.0/test/*fastq.gz /share/pkg.8/metontiime/2.1.0/test/test_result/concatenateFastq
Command exit status:
1
But I checked indeed the following fastq.gz file is in the current test/ folder:
[yshen16@scc-wa4 test]$ ls -l /share/pkg.8/metontiime/2.1.0/test/*fastq.gz
-rwxr-xr-x 1 yshen16 apps 1357266 Apr 17 12:46 /share/pkg.8/metontiime/2.1.0/test/Zymo-GridION-EVEN-BB-SN_sup_pass_filtered_27F_1492Rw_1000_reads.fastq.gz
The 'concatenateFastq' process definition in metontiime.nf is copied here:
//concatenate fastq files
process concatenateFastq {
input:
val workdir
output:
val 'flag_concatenate'
script:
if(params.concatenateFastq)
"""
mkdir -p ${params.resultsDir}
mkdir -p ${params.resultsDir}/concatenateFastq
barcodes_dirs=\$(realpath \$(find $workdir -maxdepth 1 -mindepth 1 | grep \"barcode\"));
echo \$barcodes_dirs
for b in \$barcodes_dirs; do
bn=\$(basename \$b);
f=\$(find \$b | grep \".fastq\");
zless \$f | gzip > ${params.resultsDir}/concatenateFastq/\$bn.fastq.gz;
done
"""
else
"""
mkdir -p ${params.resultsDir}
mkdir -p ${params.resultsDir}/concatenateFastq
cp $workdir/*fastq.gz ${params.resultsDir}/concatenateFastq
"""
}
Please help. I am not quite familar with nextflow and really don't know where has gone wrong. Thank you very much in advance. (edited)
Hi, I think you may have forgotten to mount /share folder. Moreover, remember to use full paths for dbSequenceFasta and dbSequenceTaxonomy. Best, SM
Thank you for replying me. I indeed realized this later, and mounted the folder in the config's singularity profile section. But now I met another issue:
ERROR ~ Error executing process > 'importDb (1)'
Caused by:
Process `importDb (1)` terminated with an error exit status (1)
Command executed:
mkdir -p /share/pkg.8/metontiime/2.1.0/test/test_result/importDb
qiime tools import --type 'FeatureData[Sequence]' --input-path 16S.fasta --output-path /share/pkg.8/metontiime/2.1.0/test/test_result/importDb/16S_sequences.qza
qiime tools import log' file f--type 'FeatureData[Taxonomy]' --input-path 16S_Taxonomy.tsv --input-format HeaderlessTSVTaxonomyFormat --output-path /share/pkg.8/metontiime/2.1.0/test/test_result/importDb/16S_taxonomy.qza
Command exit status:
1
Command output:
(empty)
Command error:
Traceback (most recent call last):
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/q2cli/builtin/tools.py", line 267, in import_data
artifact = qiime2.sdk.Artifact.import_data(type, input_path,
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/sdk/result.py", line 301, in import_data
pm = qiime2.sdk.PluginManager()
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/sdk/plugin_manager.py", line 67, in __new__
self._init(add_plugins=add_plugins)
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/sdk/plugin_manager.py", line 105, in _init
plugin = entry_point.load()
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/pkg_resources/__init__.py", line 2518, in load
return self.resolve()
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/pkg_resources/__init__.py", line 2524, in resolve
module = __import__(self.module_name, fromlist=['__name__'], level=0)
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/q2_diversity/__init__.py", line 11, in <module>
from ._beta import (beta, beta_phylogenetic, bioenv,
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/q2_diversity/_beta/__init__.py", line 13, in <module>
from ._beta_rarefaction import beta_rarefaction
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/q2_diversity/_beta/_beta_rarefaction.py", line 23, in <module>
from .._ordination import pcoa
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/q2_diversity/_ordination.py", line 20, in <module>
import umap as up
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/umap/__init__.py", line 2, in <module>
from .umap_ import UMAP
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/umap/umap_.py", line 42, in <module>
from umap.layouts import (
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/umap/layouts.py", line 41, in <module>
def rdist(x, y):
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/numba/core/decorators.py", line 234, in wrapper
disp.enable_caching()
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/numba/core/dispatcher.py", line 863, in enable_caching
self._cache = FunctionCache(self.py_func)
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/numba/core/caching.py", line 601, in __init__
self._impl = self._impl_class(py_func)
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/numba/core/caching.py", line 337, in __init__
raise RuntimeError("cannot cache function %r: no locator available "
RuntimeError: cannot cache function 'rdist': no locator available for file '/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/umap/layouts.py'
An unexpected error has occurred:
cannot cache function 'rdist': no locator available for file '/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/umap/layouts.py'
See above for debug info.
Work dir:
/share/pkg.8/metontiime/2.1.0/test/work/dd/56bd1fb4d1249d7644d726fbdd2579
Tip: you can replicate the issue by changing to the process work dir and entering the command `bash .command.run`
-- Check '.nextflow.log' file for details
Would you please help with this as well? Thanks
Did you specify full paths for fasta and tsv files and also for singularity cache dir? SM
Please attach here .conf file (in case of troubles uploading, add .txt suffix) SM
I just noticed you also forgot to close apex for dbSequencesFasta parameter.
dbSequencesFasta="16S.fasta
Please check you fixed this.
SM
Thank you and I have fixed these syntax issues and passed the directory bindings and now the pipeline seems working for the most part, but still got the error at later stage:
Command exit status:
1
Command output:
Saved FeatureTable[Frequency] to: /share/pkg.8/metontiime/2.1.0/test/test_result/collapseTables/table-collapsed-absfreq-level1.qza
Command error:
Saved FeatureTable[Frequency] to: /share/pkg.8/metontiime/2.1.0/test/test_result/collapseTables/table-collapsed-absfreq-level1.qza
Traceback (most recent call last):
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/q2cli/util.py", line 339, in _load_metadata_artifact
return artifact.view(qiime2.Metadata), None
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/sdk/result.py", line 371, in view
return self._view(view_type)
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/sdk/result.py", line 403, in _view
result = transformation(self._archiver.data_dir)
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/core/transform.py", line 70, in transformation
new_view = transformer(view)
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/core/transform.py", line 214, in wrapped
return transformer(view.file.view(self._wrapped_view_type))
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/q2_types/feature_table/_transformer.py", line 152, in _14
return _table_to_metadata(table)
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/q2_types/feature_table/_transformer.py", line 66, in _table_to_metadata
return qiime2.Metadata(table)
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/metadata/metadata.py", line 453, in __init__
self._dataframe, self._columns = self._normalize_dataframe(
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/metadata/metadata.py", line 471, in _normalize_dataframe
metadata_column = self._metadata_column_factory(series,
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/metadata/metadata.py", line 489, in _metadata_column_factory
column = NumericMetadataColumn(series, missing_scheme)
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/metadata/metadata.py", line 1012, in __init__
self._validate_index([self._series.name], axis='column')
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/metadata/metadata.py", line 159, in _validate_index
raise ValueError(
ValueError: Detected empty metadata column name. column names must consist of at least one character.
There was an issue with viewing the artifact '/share/pkg.8/metontiime/2.1.0/test/test_result/collapseTables/table-collapsed-absfreq-level1.qza' as QIIME 2 Metadata:
Detected empty metadata column name. column names must consist of at least one character.
See above for debug info.
Work dir:
/share/pkg.8/metontiime/2.1.0/test/work/cd/8e834440f659ab9e278b80d98b2fe7
Is this because my fastq sequence doesn't align with the reference database? If so, could you point me to some valid test data set? Thank you. - Yun
If you look into taxonomyVisualization or into assignTaxonomy folders, can you upload qzv files to QIIME2 View and check whether all reads were actually unclassified or if it is an issue with the taxonomy.tsv file (for example due to wrong taxa levels spacer)?
Best,
SM
Thank you. I think the previous error was caused by the mismatch between the sequence data and the reference database. I have obtained the correct one, but in this case, I again met another issue, that is, the importDb process complains the input file was not utf-8 encoded - is this a requirement ? or there is a place to configure it first? Thanks.
ERROR ~ Error executing process > 'importDb (1)'
Caused by:
Process `importDb (1)` terminated with an error exit status (1)
Command executed:
mkdir -p /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/importDb
qiime tools import .out` --type 'FeatureData[Sequence]' --input-format DNAFASTAFormat --input-path 2024.09.seqs.fna --output-path /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/importDb/2024.09.backbone.full-length.fna.qza
qiime tools import --type 'FeatureData[Taxonomy]' --input-path 2024.09.taxonomy.asv.tsv.gz --input-format HeaderlessTSVTaxonomyFormat --output-path /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/importDb/2024.09.backbone.tax.qza
Command exit status:
1
Command output:
Imported 2024.09.seqs.fna as DNAFASTAFormat to /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/importDb/2024.09.backbone.full-length.fna.qza
Command error:
Imported 2024.09.seqs.fna as DNAFASTAFormat to /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/importDb/2024.09.backbone.full-length.fna.qza
Traceback (most recent call last):
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/q2cli/builtin/tools.py", line 267, in import_data
artifact = qiime2.sdk.Artifact.import_data(type, input_path,
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/sdk/result.py", line 329, in import_data
return cls._from_view(type_, view, view_type, provenance_capture,
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/sdk/result.py", line 357, in _from_view
result = transformation(view, validate_level)
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/core/transform.py", line 68, in transformation
self.validate(view, level=validate_level)
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/core/transform.py", line 143, in validate
view.validate(level)
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/qiime2/plugin/model/file_format.py", line 34, in validate
if not self.sniff():
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/site-packages/q2_types/feature_data/_format.py", line 50, in sniff
line = fh.readline()
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/codecs.py", line 322, in decode
(result, consumed) = self._buffer_decode(data, self.errors, final)
File "/opt/conda/envs/MetONTIIME_env/lib/python3.8/encodings/utf_8_sig.py", line 69, in _buffer_decode
return codecs.utf_8_decode(input, errors, final)
UnicodeDecodeError: 'utf-8' codec can't decode byte 0x8b in position 1: invalid start byte
An unexpected error has occurred:
'utf-8' codec can't decode byte 0x8b in position 1: invalid start byte
See above for debug info.
Work dir:
/share/pkg.8/metontiime/2.1.0/test/work/cc/b0850dfbdcfe69debbb2117daed3ee
Tip: view the complete command output by changing to the process work dir and entering the command `cat .command.out`
-- Check '.nextflow.log' file for details
I think the problem is the file is gz compressed. Please, decompress it and retry. Best, SM
Thank you, and got the pipeline line move forward bit by bit. Now I met the following error in assignTaxonomy stage:
`Command output: executor > local (8) [8e/986ce1] importDb (1) | 1 of 1 \u2714 [24/e52ce4] concatenateFastq | 1 of 1 \u2714 [49/5c93db] filterFastq | 1 of 1 \u2714 [77/9d3b9a] downsampleFastq | 1 of 1 \u2714 [aa/ea45e7] importFastq | 1 of 1 \u2714 [b1/b81854] derepSeq | 1 of 1 \u2714 [11/d0e573] assignTaxonomy (1) | 1 of 1, failed: 1 \u2718 [- ] filterTaxa - [- ] taxonomyVisualization - [- ] collapseTables - [6a/131a51] dataQC | 1 of 1 \u2714 [- ] diversityAnalyses - ERROR ~ Error executing process > 'assignTaxonomy (1)'
Caused by:
Process assignTaxonomy (1) terminated with an error exit status (1)
Command executed:
mkdir -p /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/assignTaxonomy
-
Checclassifier_uc=$(awk '{print toupper($0)'} <<< Blast)
if [ "$classifier_uc" == "BLAST" ]; then qiime feature-classifier makeblastdb --i-sequences /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/importDb/2024.09.backbone.full-length.fna.qza --o-database /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/importDb/blastIndexedDb.qza
qiime feature-classifier classify-consensus-blast --i-query /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/derepSeq/rep-seqs.qza --i-blastdb /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/importDb/blastIndexedDb.qza --i-reference-taxonomy /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/importDb/2024.09.backbone.tax.qza --p-num-threads 8 --p-perc-identity 0.9 --p-query-cov 0.8 --p-maxaccepts 3 --p-min-consensus 0.7 --o-classification /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/assignTaxonomy/taxonomy.qza --o-search-results /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/assignTaxonomy/search_results.qzaelif [ "$classifier_uc" == "VSEARCH" ]; then qiime feature-classifier classify-consensus-vsearch --i-query /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/derepSeq/rep-seqs.qza --i-reference-reads /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/importDb/2024.09.backbone.full-length.fna.qza --i-reference-taxonomy /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/importDb/2024.09.backbone.tax.qza --p-perc-identity 0.9 --p-query-cov 0.8 --p-maxaccepts 100 --p-maxrejects 100 --p-maxhits 3 --p-min-consensus 0.7 --p-strand 'both' --p-unassignable-label 'Unassigned' --p-threads 8 --o-classification /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/assignTaxonomy/taxonomy.qza --o-search-results /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/assignTaxonomy/search_results.qza else echo "Classifier Blast is not supported (choose between Blast and Vsearch)" fi
qiime metadata tabulate --m-input-file /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/assignTaxonomy/taxonomy.qza --o-visualization /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/assignTaxonomy/taxonomy.qzv
qiime taxa filter-table --i-table /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/derepSeq/table.qza --i-taxonomy /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/assignTaxonomy/taxonomy.qza --p-exclude Unassigned --o-filtered-table /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/derepSeq/table-no-Unassigned.qza
Command exit status: 1
Command output: Saved BLASTDB to: /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/importDb/blastIndexedDb.qza
Command error: Saved BLASTDB to: /share/pkg.8/metontiime/2.1.0/test/Zymo_resultsDir/importDb/blastIndexedDb.qza Plugin error from feature-classifier:
'Reference taxonomy and search results do not match. The following identifiers were reported in the search results but are not present in the reference taxonomy: G000397165_2, G001941785_3, G001188915_6, G001941785_5, G001039735_1, G001297025_3, G000299455_7, G001742205_2, G001742205_4, G000248095_6, G001854105_1, G000472265_2, G007998125_1, G001941785_2, G000317975_4, G001010245_1, G001742205_5, G012955605_7, G001010245_3, G000397165_3, G001297025_1, G000472265_1, G000397165_1, G000472265_4'
Debug info has been saved to /scratch/4064886.1.w-long/qiime2-q2cli-err-40ca1tt7.log
Work dir: /share/pkg.8/metontiime/2.1.0/test/work/11/d0e573a31bd56947916b089a317a29
Tip: you can replicate the issue by changing to the process work dir and entering the command bash .command.run
-- Check '.nextflow.log' file for details ` How to add these missing identifiers in taxonomy? How to avoid this kind of error from the very beginning? That is, how to make sure the reference matches with the sequence files? Is there any parameter to be able to control the behavior, say 'ignore' such mismatches? Thanks.
Hi,
as you reported, the error is due to the fact there are some sequences in the fasta file that are not available in the taxonomy tsv file. As far as I know, there is no way to avoid this, other than downloading matched sequence/taxonomy files. However, in this specific case, the pipeline reported the following IDs are missing in the taxonomy file:
G000397165_2, G001941785_3, G001188915_6, G001941785_5, G001039735_1, G001297025_3, G000299455_7, G001742205_2, G001742205_4, G000248095_6, G001854105_1, G000472265_2, G007998125_1, G001941785_2, G000317975_4, G001010245_1, G001742205_5, G012955605_7, G001010245_3, G000397165_3, G001297025_1, G000472265_1, G000397165_1, G000472265_4
If you want to keep using this database, since the number of missing taxa is reasonably low, you may consider manually adding them in the taxonomy tsv file, copying the style of other entries, and then rerun the pipeline from the beginning.
Best,
SM
Thank you for the prompt reply. I tried several ways to get around the above error, but didn't succeed.
- first I tried to follow your advice to manully add these missing ID entries in tsv file, but I found it is difficult for me to decide how to add these details for each entry:
GB-GCA-003568775.1-MWMI01000008.1 d__Bacteria; p__; c__; o__; f__; g__; s__ 0.3 GB-GCA-001552015.1-CP010514.1 d__Bacteria; p__; c__; o__; f__; g__; s__ 0.3 GB-GCA-000008085.1-AE017199.1 d__Bacteria; p__; c__; o__; f__; g__; s__ 0.3 TAGCCGCACCCCAAGTGGTAGTCATTATTATTGGGCTTAAAGTGTTCGTAGCCGGGCCTGAAAGTCCGCTGTGAAATCCAAGCGCTCAAC d__Bacteria; p__; c__; o__; f__; g__; s__ 0.3
How do I know what to attach for each of the above IDs? can I just copy arbitary any line and just change the ID ? It sounds to me not so promising, so I didn't go further.
-
Next, I tried to use the Rscript provided in the github repo, to regenerate the taxonomy tsv, as below:
Rscript /share/pkg.8/metontiime/2.1.0/install/bin/TaxonomyTsv_from_fastaNCBI.R \ dbSequencesFasta="2024.09.seqs.fna" \ dbTaxonomyTsv="2024.09.taxonomy.asv.tsv"But the process turned out very very slow and also report some error as well, sorry I didn't keep the output as record. So I killed the prcess and gave up. -
lastly, I thought it might be more feasible for me to just remove these missing IDs in the reference set, and indeed I did and named it clean.2024.09.seqs.fna and rerun everything from scratch, and this time I got almost the same error as reported above, but with a list of new IDs: `Command error: Plugin error from feature-classifier:
'Reference taxonomy and search results do not match. The following identifiers were reported in the search results but are not present in the reference taxonomy: G001854105_5, G001807655_1, G000010145_2, G001233785_1, G000010145_5, G001742205_1, G000196035_3, G000007785_2, G000007785_3, G000648015_1, G000007785_1, G000162395_1, G001450355_1, G000010145_1, G001436835_1, G001010245_2, G000496435_1, G000472265_3, G000007785_4, G001010185_2, G003309745_1, G000159215_1, G000196035_2, G001010185_3, G001854105_4, G001368755_1, G001742205_3'
Debug info has been saved to /scratch/4390884.1.b/qiime2-q2cli-err-u29y3x77.log
Work dir: /share/pkg.8/metontiime/2.1.0/test/work/1c/d71632a02ccda6f15cba9abc5394c9
` In this case, is there any suggestion what should I do next? I wonder if you have a ready for test dataset (including the references, taxonomy tsv and the test fastq file)? if so, I would love to ask if you could share with me. All I need is just to make sure the software works. I myself do not really use it for work. I am an IT person just to help with the installation of this software. Thank you,
Yun
Hi, you may consider downloading Silva_132_release.zip from this link and then use the following files for dbSequencesFasta and dbTaxonomyTsv, respectively:
Silva_132_release.zip\SILVA_132_QIIME_release\rep_set\rep_set_16S_only\99\silva_132_99_16S.fna
Silva_132_release.zip\SILVA_132_QIIME_release\taxonomy\16S_only\99\taxonomy_7_levels.txt
Best, SM
Thank you so much for providing the above test data. I will use this to test and let you know the result.
Best, Yun
I confirm that using the database file and the taxonomy file you pointed to me worked perfectly. Thank you so much for all your valuable help! - Yun