Using TrimGalore for different rounds of adaptor cuttings

[carmencita]

Hi!

I am trying to implement the following cutadapt command using TrimGalore:

cutadapt -m 20 -O 20 -a "polyA=A{20}" -a "QUALITY=G{20}" -n 2 fastq_extracted/sample/R1.fastq.gz | 
cutadapt -m 20 -O 3 --nextseq-trim=10  -a "r1adapter=A{18}AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=3;max_error_rate=0.100000" - | 
cutadapt -m 20 -O 3 -a "r1polyA=A{18}" - | 
cutadapt -m 20 -O 20 -g "r1adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=20" --discard-trimmed -o fastq_trimmed/sample/R1.fastq.gz - 

to analyse Lexogen data

https://github.com/Lexogen-Tools/quantseqpool_analysis/blob/master/QuantSeqPoolAnalysis.sh

I know that TrimGalore can be used with different adaptor sequences (https://github.com/FelixKrueger/TrimGalore/issues/86). The equivalent TrimGalore command using multiple adaptors would then look as follows:

trimgalore -a " polyA=A{20} -a QUALITY=G{20} -a r1adapter=A{18}AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=3;max_error_rate=0.100000 -a r1polyA=A{18} -g r1adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=20 -n 4" --nextseq 10

However, I am unsure how to provide the --discard-trimmed , the changing -O and the --nextseq 10 option as they are executed in different rounds. Should I put them under the TrimGalore -a option? Or is there a workaround you could suggest? For the context: I would like to use cutadapt via TrimGalore because TrimGalore is integrated in the Nextflow RNA-seq pipeline. Thank you for your help.