Update the following URL to point to the GitHub repository of the package you wish to submit to Bioconductor

Repository: https://https://github.com/CTrierMaansson/DNAfusion

Confirm the following by editing each check box to '[x]'

[x] I understand that by submitting my package to Bioconductor, the package source and all review commentary are visible to the general public.
[x] I have read the Bioconductor Package Submission instructions. My package is consistent with the Bioconductor Package Guidelines.
[x] I understand Bioconductor Package Naming Policy and acknowledge Bioconductor may retain use of package name.
[x] I understand that a minimum requirement for package acceptance is to pass R CMD check and R CMD BiocCheck with no ERROR or WARNINGS. Passing these checks does not result in automatic acceptance. The package will then undergo a formal review and recommendations for acceptance regarding other Bioconductor standards will be addressed.
[x] My package addresses statistical or bioinformatic issues related to the analysis and comprehension of high throughput genomic data.
[x] I am committed to the long-term maintenance of my package. This includes monitoring the support site for issues that users may have, subscribing to the bioc-devel mailing list to stay aware of developments in the Bioconductor community, responding promptly to requests for updates from the Core team in response to changes in R or underlying software.
[x] I am familiar with the Bioconductor code of conduct and agree to abide by it.

I am familiar with the essential aspects of Bioconductor software management, including:

[x] The 'devel' branch for new packages and features.
[x] The stable 'release' branch, made available every six months, for bug fixes.
[x] Bioconductor version control using Git (optionally via GitHub).

For questions/help about the submission process, including questions about the output of the automatic reports generated by the SPB (Single Package Builder), please use the #package-submission channel of our Community Slack. Follow the link on the home page of the Bioconductor website to sign up.

Aug 31 '22 18:08 CTrierMaansson

Hi @CTrierMaansson

Thanks for submitting your package. We are taking a quick look at it and you will hear back from us soon.

The DESCRIPTION file for this package is:

Package: DNAfusion
Title: Identification of gene fusions using paired-end sequencing
Version: 0.99.0
biocViews: TargetedResequencing, Genetics, GeneFusionDetection, Sequencing
Authors@R: 
    c(person(given = "Christoffer Trier", family = "Maansson", , email = "[email protected]", role = c("aut", "cre"),
 comment = c(ORCID = "0000-0002-3071-3437")),
    person(given = "Emma Roger", family = "Andersen", , email = "[email protected]", role = c("ctb", "rev")),
    person(given = "Maiken Parm", family = "Ulhoi", , email = "[email protected]", role = "dtc"),
    person(given = "Peter", family = "Meldgaard", , email = "[email protected]", role = "dtc"),
    person(given = "Boe Sandahl", family = "Sorensen", , email = "[email protected]", role = c("rev", "fnd")))
Description: Paired-end sequencing of cfDNA generated BAM files can be used as input to
  discover EML4-ALK variants. This package was developed using position deduplicated BAM
  files generated with the AVENIO Oncology Analysis Software. These files are made using
  the AVENIO ctDNA surveillance kit and Illumina Nextseq 500 sequencing. This is a targeted 
  hybridization NGS approach and includes ALK-specific but not EML4-specific probes. 
License: GPL-3
Encoding: UTF-8
Roxygen: list(markdown = TRUE)
RoxygenNote: 7.2.1
Suggests: 
    knitr,
    rmarkdown,
    usethis,
    devtools,
    testthat,
    BiocStyle,
    sessioninfo
VignetteBuilder: knitr
Imports:
 bamsignals,
  GenomicRanges,
  IRanges,
  Rsamtools
Depends:
  dplyr,
  R (>= 4.2.0)
BugReports: https://github.com/CTrierMaansson/DNAfusion/issues
URL: https://github.com/CTrierMaansson/DNAfusion

Aug 31 '22 18:08 bioc-issue-bot

Thanks for this submission. I think

head(EML4_ALK_detection(file = H3122_bam, 
                        genome = "hg38", 
                        mates = 2))
#>          pos cigar     mpos
#> 726 42299657 94M2S 29223691
#> 727 42299657 94M2S 29223375
#> 728 42299657 94M2S 29223479
#> 729 42299657 94M2S 29223686
#> 731 42299657 94M2S 29223636
#> 733 42299657 94M2S 29223687
#>                                                                                                  seq
#> 726 TTGCTTCTTTCACTTAGTTTTTTTTGTTTTGTTTTGTTTGTTTGTTTTTTGAGATGGGGTTTCACTCTTGTTGCCCAGGCTGGAGTGCAGTGGTCT
#> 727 TTGCTTCTTTCACTTAGTTTTTTTTGTTTTGTTTTGTTTGTTTGTTTTTTGAGATGGGGTTTCACTCTTGTTGCCCAGGCTGGAGTGCAGTGGTCT
#> 728 TTGCTTCTTTCACTTAGTTTTTTTTGTTTTGTTTTGTTTGTTTGTTTTTTGAGATGGGGTTTCACTCTTGTTGCCCAGGCTGGAGTGCAGTGGTCT
#> 729 TTGCTTCTTTCACTTAGTTTTTTTTGTTTTGTTTTGTTTGTTTGTTTTTTGAGATGGGGTTTCACTCTTGTTGCCCAGGCTGGAGTGCAGTGGTCT
#> 731 TTGCTTCTTTCACTTAGTTTTTTTTGTTTTGTTTTGTTTGTTTGTTTTTTGAGATGGGGTTTCACTCTTGTTGCCCAGGCTGGAGTGCAGTGGTCT
#> 733 TTGCTTCTTTCACTTAGTTTTTTTTGTTTTGTTTTGTTTGTTTGTTTTTTGAGATGGGGTTTCACTCTTGTTGCCC

should not be a data frame but an instance of a class deriving from GenomicAlignments. Would you have a look at GenomicAlignments package? I think the Bioconductor representations may be advantageous.

Sep 11 '22 14:09 vjcitn

Hello

Hello I have changed the output of EML4_ALK_detection() to a GAlingments object. Futhermore, I have made the appropriate changes to the other functions, as well as the documentation.

I have changed this at my GitHub repository, however I'm unsuccefull in pushing the update to [email protected]:packages/DNAfusion.git. Am I doing something wrong?

Kind regards Christoffer

Sep 12 '22 18:09 CTrierMaansson

be sure to read the FAQ about git pushing issues and consider pushing to https://github.com/bioconductor.org/packages/DNAfusion

Sep 12 '22 18:09 vjcitn

Hi Christoffer @CTrierMaansson and Vince @vjcitn I believe once the package passes the 1. Awaiting Moderation stage, it will be added to the Bioconductor git server. Lori can confirm this @lshep Best, Marcel

Sep 12 '22 18:09 LiNk-NY

Oh, right, I have to change the labels once I look at the revisions. Thanks @LiNk-NY !!

Sep 12 '22 18:09 vjcitn

Even when it gets to "pre-check passed" there is a manual ingestion step needed.

Sep 12 '22 18:09 vjcitn

I'm sorry. Do I need to do anything? or do I need to wait until @vjcitn changes the labels?

Sep 12 '22 19:09 CTrierMaansson

I'm sorry. Do I need to do anything? or do I need to wait until @vjcitn changes the labels?

Hi Christoffer, @CTrierMaansson You do not need to do anything. We are a little backed up and your package will be ingested soon. Best, Marcel

Sep 19 '22 21:09 LiNk-NY

A reviewer has been assigned to your package. Learn what to expect during the review process.

IMPORTANT: Please read this documentation for setting up remotes to push to git.bioconductor.org. It is required to push a version bump to git.bioconductor.org to trigger a new build.

Bioconductor utilized your github ssh-keys for git.bioconductor.org access. To manage keys and future access you may want to active your Bioconductor Git Credentials Account

Sep 26 '22 14:09 bioc-issue-bot

Dear Package contributor,

This is the automated single package builder at bioconductor.org.

Your package has been built on Linux, Mac, and Windows.

Congratulations! The package built without errors or warnings on all platforms.

Please see the build report for more details. This link will be active for 21 days.

Remember: if you submitted your package after July 7th, 2020, when making changes to your repository push to [email protected]:packages/DNAfusion to trigger a new build. A quick tutorial for setting up remotes and pushing to upstream can be found here.

Sep 26 '22 14:09 bioc-issue-bot

Hi Christoffer, @CTrierMaansson Thank you for the submission. Sorry for the delay. Please see the review below. Feel free to post any questions. Best, Marcel

DNAfusion #2759

DESCRIPTION

Looks good.
Are usethis and devtools needed in the Suggests?

NAMESPACE

Looks good.

vignettes

Avoid the code duplication and assign the output of EML4_ALK_detection to a variable(s) and re-use.

R

Avoid using numeric indices and use named indices, e.g., 3 in index_helper.
Return an empty GAlignments() instead of the message "No EML4-ALK was detected" in EML4_ALK_detection and check any downstream results with isEmpty().
Optional. Minor. Consider using BiocBaseUtils for type checking e.g., with isScalarCharacter.

test

It's great that you have tests. 100% coverage is quite feasible, I think.

> covr::package_coverage()
DNAfusion Coverage: 87.07%
R/DNAfusion_functions.R: 87.07%

Oct 13 '22 15:10 LiNk-NY

Received a valid push on git.bioconductor.org; starting a build for commit id: 019031e00f8f0ab3a06446d083db041837057844

Oct 14 '22 12:10 bioc-issue-bot

Dear Package contributor,

This is the automated single package builder at bioconductor.org.

Your package has been built on Linux, Mac, and Windows.

Congratulations! The package built without errors or warnings on all platforms.

Please see the build report for more details. This link will be active for 21 days.

Remember: if you submitted your package after July 7th, 2020, when making changes to your repository push to [email protected]:packages/DNAfusion to trigger a new build. A quick tutorial for setting up remotes and pushing to upstream can be found here.

Oct 14 '22 12:10 bioc-issue-bot

Dear Marcel

Thank you for the review!

DNAfusion #2759

Description

Are usethis and devtools needed in the Suggests?

usethis has been removed from Suggests
devtools::session_info is used in the vignettes and devtools is therefore in Suggests

vignettes

Avoid the code duplication and assign the output of EML4_ALK_detection to a variable(s) and re-use.

I have now created two variables (H3122_result & HCC827_result) as the output of EML4_ALK_detection

R

Avoid using numeric indices and use named indices, e.g., 3 in index_helper.

This has been implemented and the package now uses named indices, e.g., "index" & "seq"

Return an empty GAlignments() instead of the message "No EML4-ALK was detected" in EML4_ALK_detection and check any downstream results with isEmpty().

When no gene fusions are detected EML4_ALK_detection now returns a empty GAlignments object. The downstream functions now check if the parameter reads is empty using isEmpty. Becuase og this S4Vectors has been added to the DESCRIPTION and the NAMESPACE.

Optional. Minor. Consider using BiocBaseUtils for type checking e.g., with isScalarCharacter.

A good suggestion. Where applicable isa has been substituted with BiocBaseUtils functions. BiocBaseUtils has been added to the DESCRIPTION and NAMESPACE

test

It's great that you have tests. 100% coverage is quite feasible, I think.

The tests should now have a coverage of 100%

Oct 14 '22 13:10 CTrierMaansson

Hi Christoffer, @CTrierMaansson

Thank you for making those changes. One, minor follow up:

devtools::session_info is used in the vignettes and devtools is therefore in Suggests

devtoools points to sessioninfo so it is better to simply add sessioninfo to the Suggests field.

The package looks to be in good shape for acceptance. Best regards, Marcel

Oct 14 '22 16:10 LiNk-NY

Received a valid push on git.bioconductor.org; starting a build for commit id: c977f353f69bd2bb8f0d8c4f960df35cbf2d4290

Oct 16 '22 06:10 bioc-issue-bot

Hi Marcel, @LiNk-NY

Thank you!

devtoools points to sessioninfo so it is better to simply add sessioninfo to the Suggests field.

Good point! I had missed this. I've made the change to the Suggests

Best regards

Christoffer

Oct 16 '22 06:10 CTrierMaansson

Dear Package contributor,

This is the automated single package builder at bioconductor.org.

Your package has been built on Linux, Mac, and Windows.

Congratulations! The package built without errors or warnings on all platforms.

Please see the build report for more details. This link will be active for 21 days.

Remember: if you submitted your package after July 7th, 2020, when making changes to your repository push to [email protected]:packages/DNAfusion to trigger a new build. A quick tutorial for setting up remotes and pushing to upstream can be found here.

Oct 16 '22 06:10 bioc-issue-bot

Your package has been accepted. It will be added to the Bioconductor nightly builds.

Thank you for contributing to Bioconductor!

Reviewers for Bioconductor packages are volunteers from the Bioconductor community. If you are interested in becoming a Bioconductor package reviewer, please see Reviewers Expectations.

Oct 17 '22 14:10 bioc-issue-bot

The master branch of your GitHub repository has been added to Bioconductor's git repository.

To use the git.bioconductor.org repository, we need an 'ssh' key to associate with your github user name. If your GitHub account already has ssh public keys (https://github.com/CTrierMaansson.keys is not empty), then no further steps are required. Otherwise, do the following:

See further instructions at

https://bioconductor.org/developers/how-to/git/

for working with this repository. See especially

https://bioconductor.org/developers/how-to/git/new-package-workflow/ https://bioconductor.org/developers/how-to/git/sync-existing-repositories/

to keep your GitHub and Bioconductor repositories in sync.

Your package will be included in the next nigthly 'devel' build (check-out from git at about 6 pm Eastern; build completion around 2pm Eastern the next day) at

https://bioconductor.org/checkResults/

(Builds sometimes fail, so ensure that the date stamps on the main landing page are consistent with the addition of your package). Once the package builds successfully, you package will be available for download in the 'Devel' version of Bioconductor using BiocManager::install("DNAfusion"). The package 'landing page' will be created at

https://bioconductor.org/packages/DNAfusion

If you have any questions, please contact the bioc-devel mailing list (https://stat.ethz.ch/mailman/listinfo/bioc-devel); this issue will not be monitored further.

Oct 18 '22 13:10 lshep

We had an issue processing packages -- I'm temporarily reopening so I can reprocess and get your package on the daily builders. Sorry for any confusion and delay

Oct 26 '22 12:10 lshep

Dear @CTrierMaansson ,

We have reopened the issue to continue the review process. Please remember to push a version bump to git.bioconductor.org to trigger a new build.

Oct 26 '22 12:10 bioc-issue-bot

The master branch of your GitHub repository has been added to Bioconductor's git repository.

To use the git.bioconductor.org repository, we need an 'ssh' key to associate with your github user name. If your GitHub account already has ssh public keys (https://github.com/CTrierMaansson.keys is not empty), then no further steps are required. Otherwise, do the following:

See further instructions at

https://bioconductor.org/developers/how-to/git/

for working with this repository. See especially

https://bioconductor.org/developers/how-to/git/new-package-workflow/ https://bioconductor.org/developers/how-to/git/sync-existing-repositories/

to keep your GitHub and Bioconductor repositories in sync.

Your package will be included in the next nigthly 'devel' build (check-out from git at about 6 pm Eastern; build completion around 2pm Eastern the next day) at

https://bioconductor.org/checkResults/

(Builds sometimes fail, so ensure that the date stamps on the main landing page are consistent with the addition of your package). Once the package builds successfully, you package will be available for download in the 'Devel' version of Bioconductor using BiocManager::install("DNAfusion"). The package 'landing page' will be created at

https://bioconductor.org/packages/DNAfusion

If you have any questions, please contact the bioc-devel mailing list (https://stat.ethz.ch/mailman/listinfo/bioc-devel); this issue will not be monitored further.

Oct 26 '22 12:10 lshep

Contributions Contributions copied to clipboard

DNAfusion

DNAfusion #2759

DESCRIPTION

NAMESPACE

vignettes

R

test

DNAfusion #2759

Description

vignettes

R

test

Contributions
Contributions copied to clipboard