no .rev.1.bt2 and .rev.2.bt2

[microsat2018]

Ran the following command line in my red hat enterprise linux 7.4. The bowtie2 version is 2.3.4.1.

$bowtie2-build --threads 2 -o 3 a.fasta a.fasta

It produced only four files a.fasta.1.bt2 a.fasta.2.bt2 a.fasta.3.bt2 a.fasta.4.bt2

but no a.fasta.rev.1.bt2 a.fasta.rev.2.bt2

The a.fasta is fasta file

a1 CATGTCCAGCTTCTCTTCAGTACCGCTCACCAGCCTAGGTGGGACCACTGACTGTGAGTC TGCAGTGGCCACCGCCCAGTCTCTGTGTCTCAAGCTCCAAGAGACGGTCACACACTAACC TGCAAGCCAAGGCTGGTGACTTTGACCATCCCTAACGCATGAGTTTTCCATGGAAACCTG GTCGGTGAACCTGACACGAAATTCCCAATTCCCCTTTACTCTGTACTGTGTGGCTGGTGC TCTTGTTTTCGTTCTCTCTCTCTCTCTCTCTCTCTCTCAAGTTGATTCCTCCATGTTGCT TTACAGAGACCTGCCAACTACCCAGGAATGTAAAAGCATTCATAGTATTTGTCTAGTAGA

Can anyone help me with this issue?

I ran the same command with same a.fasta in a red hat server, and it gave all the six files correctly. This server has 1000G memory. My redhat enterprise linux 7.4 is 8G memory only. Is the difference in the memory capacity that caused the problem?

[ch4rr0]

I run the same command that you did and bowtie 2 did produce both reverse indexes. If your reference consists of only the text that you posted above then 8 Gb of R.A.M. should be more than enough to produce an index.

[edkonyakhina]

Hello! I also have the same problem. I am trying to build index, using GRCh38 reference connected with it's introns, but Bawtie2 doesn't produce reverse indexes. My input is: bowtie2-build --offrate 1 trans_and_introns.fa trans_and_introns Help me please.

Many thanks, Evgeniya

[ch4rr0]

Hello,

Would you mind giving this alpha build a try? It contains a potential fix for this issue. Please let us know whether the issue persists.

[edkonyakhina]

Hello! Thank you for answer! I will inform you about results.

Many thanks, Evgeniya

[edkonyakhina]

Unfortunately, while running this alpha build rev files also weren't produced. And one of *.bt2 files was made empty.

Many thanks, Evgeniya

[ch4rr0]

Would you be able to share your reference file and command line?

[ch4rr0]

Sorry, didn't realize you already posted this information in a previous thread.

I was able to build a complete index using bowtie 2 v2.3.4.1. Here's the evidence:

$ ./bowtie2-build --threads 23 --offrate 1 hg38.fa hg38
...
$ ls
AUTHORS                bowtie2-build-l          bowtie2-inspect-s        hg38.4.bt2       NEWS
bowtie2                bowtie2-build-l-debug    bowtie2-inspect-s-debug  hg38.fa          scripts
bowtie2-align-l        bowtie2-build-s          doc                      hg38.rev.1.bt2   TUTORIAL
bowtie2-align-l-debug  bowtie2-build-s-debug    example                  hg38.rev.2.bt2   VERSION
bowtie2-align-s        bowtie2-inspect          hg38.1.bt2               LICENSE
bowtie2-align-s-debug  bowtie2-inspect-l        hg38.2.bt2               MANUAL
bowtie2-build          bowtie2-inspect-l-debug  hg38.3.bt2               MANUAL.markdown

Are you using a conda-installed bowtie 2 binary? These are the binaries that have exhibited such behavior. See issue #194.

[edkonyakhina]

No. I don't use conda, I recognized that it was my fault. I used too big file, that I didn't need. Now all works okey. Thank you for ypur attention and quick answers!

Many thanks, Evgeniya

[ch4rr0]

Appreciate you following up. The bowtie2-build wrapper script should have calculated the reference file size and choose an appropriate index. There may be a flaw in our logic. I’ll look into that.

I will close this thread for the time being.

[palakjolly]

I am having the same issue- while the first four files are being produced the two reverse indexes are not. This issue is not because of Conda since I installed the pre built package from sourceforge. My code is as follows: ./bowtie2-build -f ~/Desktop/GCF_000001635.26_GRCm38.p6_genomic.fna mm10refseq After waiting a while, this is the dir: AUTHORS bowtie2-align-l-debug.exe bowtie2-build.bat bowtie2-build-s-debug.exe bowtie2-inspect-l-debug.exe example mm10refseq.3.bt2 scripts bowtie2 bowtie2-align-s.exe bowtie2-build-l.exe bowtie2-inspect bowtie2-inspect-s.exe LICENSE mm10refseq.4.bt2 TUTORIAL bowtie2.bat bowtie2-align-s-debug.exe bowtie2-build-l-debug.exe bowtie2-inspect.bat bowtie2-inspect-s-debug.exe MANUAL NEWS VERSION bowtie2-align-l.exe bowtie2-build bowtie2-build-s.exe bowtie2-inspect-l.exe doc MANUAL.markdown As you can see, the reverse index is not being created. I use Git Bash on a Windows 8. I would appreciate your help.

[ch4rr0]

Looking into this

[ch4rr0]

I was able to recreate the issue with the exact same reference file that you used. I have not been able to find the cause of the issue though, but I am still looking.

[ch4rr0]

@palakjolly -- We think that we may found the cause of this issue and have pushed a potential fix. Would you mind assisting us with testing the changeset to verify whether or not it works? I can provide a build if you need one.

Thank you.