sguizard
results not matching data and changing the -sc not working
The dmel example command works so your code is apparently OK
BUT
I have no results with my data and the default (1kb) while the data supports counts; additionally, I added -sc 100 but the csv file is still showing 1kb intervals.
I suspected a parsing problem due to maybe the pipes in my scaffold names and changed the pipes| to _ without improvement. I also added 1 to the end coordinate to not have 0-length and no better. I am lost! my columns match your dme demo file which works out ... Does the content of the last field matter? what is counted by Density, the footprint (base number) on the chromosome or the number of rows intersecting the interval?
DensityMap.pl -i motifs.gff -o F1_modified_base.svg -ty "modified_base=fused" -sc 100
# head of the csv
sequence feature start end density
000029F|arrow modified_base 0 1000 0
000029F|arrow modified_base 1000 2000 0
000029F|arrow modified_base 2000 3000 0
000029F|arrow modified_base 3000 4000 0
000029F|arrow modified_base 4000 5000 0
000029F|arrow modified_base 5000 6000 0
000029F|arrow modified_base 6000 7000 0
000029F|arrow modified_base 7000 8000 0
000029F|arrow modified_base 8000 9000 0
The input data
##gff-version 3
##source ipdSummary v2.0
##sequence-region 000029F|arrow 1 156279
000029F|arrow kinModCall modified_base 5719 5719 42 + . coverage=33;context=TATCATGCCCTTGAAAATTCTTCTGGCAACAAAACAACACG;IPDRatio=3.49
000029F|arrow kinModCall modified_base 7070 7070 32 + . coverage=44;context=AAGTTGAAAAGAATCAACGAACTTAACAATAAACTGAGGAA;IPDRatio=2.63
000029F|arrow kinModCall modified_base 7233 7233 33 + . coverage=46;context=ATTTTATAGAGGGTTTGAAAAATGCTCAAAAAAATAGCCAA;IPDRatio=2.81
000029F|arrow kinModCall modified_base 7435 7435 31 + . coverage=42;context=CGGTAATCTTATCTTTATTGTTAGACTTCGCAGAAATTTCC;IPDRatio=2.55
000029F|arrow kinModCall modified_base 7440 7440 31 - . coverage=35;context=CTAAAGGAAATTTCTGCGAAGTCTAACAATAAAGATAAGAT;IPDRatio=2.90
000029F|arrow kinModCall modified_base 7540 7540 42 - . coverage=38;context=TAGCGAACTATACCTAAAAGGGTGGGCATTGGTTAACATTA;IPDRatio=2.76
000029F|arrow kinModCall modified_base 8239 8239 32 - . coverage=36;context=GGATTTGGTTAGAGAAAAGCTCTTGACAATTATGAATACCA;IPDRatio=3.09
000029F|arrow kinModCall modified_base 8259 8259 31 + . coverage=49;context=AGCTTTTCTCTAACCAAATCCTTCAACATTGTTTTATCTAC;IPDRatio=2.47
000029F|arrow kinModCall modified_base 8405 8405 31 - . coverage=40;context=AACTGTTAATCTTCGTATCGAGTGATGTGTTAGAAGCGTTG;IPDRatio=2.90
000029F|arrow kinModCall modified_base 8560 8560 36 + . coverage=46;context=TGAAAGCCTAGCTAAAGTTCTCTGGTCGTGCAACATTCGAG;IPDRatio=3.86
Any idea what is wrong with my analysis? Thanks
