fastp icon indicating copy to clipboard operation
fastp copied to clipboard

ERROR: '+' expected

Open spw6422 opened this issue 1 year ago • 5 comments

Hello. I keep getting the same error when running my RNA-seq data with fastp. The error implies that there is a '+' missing, but I don't see that in my fastq file. Please help.

Here is an example:

Command: fastp --in1 R2_FKRN240086271-1A_2253CMLT4_L7_1.fq --out1 fastp_R2_1_trimmed.fq --in2 R2_FKRN240086271-1A_2253CMLT4_L7_2.fq --out2 fastp_R2_2_trimmed.fq

Error message: Expected '+', got @LH00281:101:2253CMLT4:7:1153:17937:24071 2:N:0:GAAGACTAGC+TAGGAAGAGC ERROR: '+' expected

I found the line in the fastq file where this error message is pointing to, and don't see any '+' missing: Screenshot 2024-06-05 at 9 53 46 AM

spw6422 avatar Jun 05 '24 07:06 spw6422

 Could you please upload a piece of your data so that I can reproduce this issue?   ------------------ Original ------------------ From: @.>; Date:  Wed, Jun 5, 2024 03:56 PM To: @.>; Cc: @.***>; Subject:  [OpenGene/fastp] ERROR: '+' expected (Issue #565)

 

Hello. I keep getting the same error when running my RNA-seq data with fastp. The error implies that there is a '+' missing, but I don't see that in my fastq file. Please help.

Here is an example:

Command: fastp --in1 R2_FKRN240086271-1A_2253CMLT4_L7_1.fq --out1 fastp_R2_1_trimmed.fq --in2 R2_FKRN240086271-1A_2253CMLT4_L7_2.fq --out2 fastp_R2_2_trimmed.fq

Error message: Expected '+', got @LH00281:101:2253CMLT4:7:1153:17937:24071 2:N:0:GAAGACTAGC+TAGGAAGAGC ERROR: '+' expected

I found the line in the fastq file where this error message is pointing to, and don't see any '+' missing: Screenshot.2024-06-05.at.9.53.46.AM.png (view on web)

— Reply to this email directly, view it on GitHub, or unsubscribe. You are receiving this because you are subscribed to this thread.Message ID: @.***>

sfchen avatar Jun 06 '24 02:06 sfchen

I uploaded here 1M reads each of my forward and reverse files: https://1drv.ms/f/s!AlHK-h6IM1EWl-o0nQvUh8iCeZ5VYA?e=AF7xpe

I ran the following command: fastp --in1 R2_F_1M.fq --out1 fastp_R2_1_trimmed.fq --in2 R2_R_1M.fq --out2 fastp_R2_2_trimmed.f

And got the following message: Expected '+', got TCTTCGCCGACCTTCGCCGGCCTCAGCGCCACCGGGCGCAGCAGGAAAGACGGCACGTGGTCGCCCAGTCCAATGACGGGCGGCCCATCGTCTTCATGATGGCGCGGGCGGCGCTCACGACGGTCTGCGACAGGCGCCCCGGCCGGCGCC ERROR: '+' expected

Not sure if this information is helpful: I am using a MacBook Pro with Apple M3 Pro chip.

spw6422 avatar Jun 06 '24 12:06 spw6422

I just wanted to provide an update that I ran the exact same code using the exact same data, but on my institution's clusters (instead of my personal MacBook), and it worked perfectly.

spw6422 avatar Jun 10 '24 06:06 spw6422

I checked your data, seems that the file R2_R_1M.fq is with bad format

@LH00281:101:2253CMLT4:7:1105:33021:5553 2:N:0:GAAGACTAGC+TAGGAAGAGC
TGCTACTATTGCTATCGCAGCTCTTTCTTCATGTGCAATGACCGTACCTGTGGCTGCTACGAGCAACCCAATCGGCAGTAAAGTAGGCACTTCCACCGGTTCCGGTTTTTTGGGAGTTCTTATCTTCTCGCCTGATACCGGCATTCAACA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@LH00281:101:2253CMLT4:7:1105:33377:5553 2:N:0:GIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@LH00281:101:2253CMLT4:7:1167:24751:12668 1:N:0:GAAGACTAGC+TAGGAAGAGC
TCTTCGCCGACCTTCGCCGGCCTCAGCGCCACCGGGCGCAGCAGGAAAGACGGCACGTGGTCGCCCAGTCCAATGACGGGCGGCCCATCGTCTTCATGATGGCGCGGGCGGCGCTCACGACGGTCTGCGACAGGCGCCCCGGCCGGCGCC
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

sfchen avatar Jul 03 '24 12:07 sfchen

and the two files have different line numbers:

wc -l *.fq                
 4000000 R2_F_1M.fq
 3999297 R2_R_1M.fq

sfchen avatar Jul 03 '24 12:07 sfchen

I've also gotten the same error with fastq files that had Windows/DOS style CRLF line endings.

jesvedberg avatar Apr 02 '25 21:04 jesvedberg

can you try the latest version?

sfchen avatar May 28 '25 06:05 sfchen

closing as fixed

sfchen avatar May 30 '25 22:05 sfchen